Incidental Mutation 'R1689:Olfr356'
ID189548
Institutional Source Beutler Lab
Gene Symbol Olfr356
Ensembl Gene ENSMUSG00000070943
Gene Nameolfactory receptor 356
SynonymsGA_x6K02T2NLDC-33631647-33632594, MOR134-1
MMRRC Submission 039722-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R1689 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location36937121-36938068 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36937977 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 286 (N286S)
Ref Sequence ENSEMBL: ENSMUSP00000092631 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095021]
Predicted Effect probably damaging
Transcript: ENSMUST00000095021
AA Change: N286S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000092631
Gene: ENSMUSG00000070943
AA Change: N286S

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.1e-52 PFAM
Pfam:7tm_1 41 290 4.9e-19 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 T C 7: 46,120,403 K896R probably benign Het
Adcy9 A T 16: 4,297,562 probably null Het
Adgre1 T C 17: 57,449,921 F726S probably benign Het
Ahctf1 A T 1: 179,768,383 S148T probably damaging Het
Aif1 G A 17: 35,172,151 P44L probably benign Het
Ammecr1l C A 18: 31,780,688 A289D probably benign Het
Amotl1 T C 9: 14,593,222 Y230C probably damaging Het
Armc6 A T 8: 70,229,537 S65R probably benign Het
Atad2b T A 12: 5,034,575 Y1440* probably null Het
Atf6b T A 17: 34,650,302 D164E probably damaging Het
B020004J07Rik T A 4: 101,837,179 K169I possibly damaging Het
B4galt6 C T 18: 20,706,496 S127N probably benign Het
Bcl11a A T 11: 24,163,167 Y170F probably damaging Het
Bcl11a A T 11: 24,164,406 D583V possibly damaging Het
Btnl1 T A 17: 34,381,208 Y228* probably null Het
C130060K24Rik A G 6: 65,381,607 N105S possibly damaging Het
Cav2 A G 6: 17,281,422 H21R probably benign Het
Celsr2 T A 3: 108,407,304 D1135V possibly damaging Het
Cntnap1 A C 11: 101,188,873 probably null Het
Cysltr2 T C 14: 73,030,030 D80G possibly damaging Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Dgkh A T 14: 78,618,544 M363K possibly damaging Het
Eml5 C T 12: 98,830,935 V1112M probably damaging Het
Entpd7 A G 19: 43,725,476 T425A probably damaging Het
Ephx2 T A 14: 66,087,026 K373* probably null Het
F5 G C 1: 164,198,917 R1686P probably damaging Het
Fbxw10 A T 11: 62,860,036 I482L probably damaging Het
Fbxw8 T C 5: 118,077,617 S443G probably damaging Het
Fdft1 T C 14: 63,156,689 E191G probably benign Het
Fgd2 A G 17: 29,363,722 E26G probably benign Het
Gabra4 T C 5: 71,633,542 probably null Het
Gc A G 5: 89,441,200 probably null Het
Heatr1 T A 13: 12,424,625 D1361E probably benign Het
Hid1 A G 11: 115,360,357 F118L probably damaging Het
Igsf8 G T 1: 172,318,937 G564W probably damaging Het
Il12rb2 A G 6: 67,336,760 V4A probably benign Het
Irak3 T C 10: 120,146,552 E335G probably damaging Het
Itgb8 T G 12: 119,170,820 Q504P probably benign Het
Kbtbd12 A T 6: 88,618,585 Y88N probably damaging Het
Klk1b5 T C 7: 44,220,545 I226T probably damaging Het
L3hypdh A T 12: 72,084,753 I135N probably damaging Het
Lrp2 G T 2: 69,503,529 T1456K probably benign Het
Mrgprd C A 7: 145,321,717 Y108* probably null Het
Muc6 C T 7: 141,647,998 G742D probably damaging Het
Nalcn T A 14: 123,285,254 I1572F probably damaging Het
Nceh1 A G 3: 27,226,082 Y126C probably damaging Het
Olfr125 T C 17: 37,835,604 S202P possibly damaging Het
Olfr867 A T 9: 20,055,126 N112K possibly damaging Het
Pacs1 G T 19: 5,272,615 probably benign Het
Pappa2 A G 1: 158,957,398 L14P probably damaging Het
Pdlim2 C T 14: 70,171,239 G176D probably damaging Het
Ptpra T C 2: 130,503,492 F5L probably benign Het
Ralgapa1 A G 12: 55,676,767 L2114P possibly damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Senp2 T A 16: 22,026,666 Y217N probably damaging Het
Sned1 C T 1: 93,283,372 R1061C probably damaging Het
Spag16 C T 1: 70,461,118 T535I probably benign Het
Supt20 T A 3: 54,712,162 L355* probably null Het
Tmem132b A G 5: 125,787,614 H928R possibly damaging Het
Tpo A T 12: 30,098,246 L552H probably damaging Het
Tsfm A T 10: 127,028,455 N130K probably damaging Het
Usp48 T A 4: 137,656,107 probably null Het
Vsig10 A G 5: 117,352,760 D544G probably benign Het
Vsig10l C T 7: 43,465,368 T433I possibly damaging Het
Wdr81 A G 11: 75,445,596 F1655L probably damaging Het
Wfdc3 T A 2: 164,734,191 D60V probably damaging Het
Other mutations in Olfr356
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02209:Olfr356 APN 2 36937505 missense probably damaging 1.00
IGL02457:Olfr356 APN 2 36937748 missense probably damaging 0.99
IGL02933:Olfr356 APN 2 36937298 missense probably damaging 1.00
IGL03304:Olfr356 APN 2 36937548 missense probably damaging 0.99
IGL03350:Olfr356 APN 2 36937583 missense probably damaging 1.00
IGL03050:Olfr356 UTSW 2 36937623 missense probably damaging 0.99
R0124:Olfr356 UTSW 2 36937256 missense possibly damaging 0.80
R1447:Olfr356 UTSW 2 36937776 missense possibly damaging 0.54
R1591:Olfr356 UTSW 2 36937978 missense probably damaging 1.00
R1651:Olfr356 UTSW 2 36937323 missense probably damaging 0.99
R1876:Olfr356 UTSW 2 36937763 missense possibly damaging 0.80
R2132:Olfr356 UTSW 2 36937692 missense probably benign 0.00
R2308:Olfr356 UTSW 2 36937300 nonsense probably null
R3004:Olfr356 UTSW 2 36937209 missense possibly damaging 0.64
R4180:Olfr356 UTSW 2 36937230 missense probably damaging 0.98
R4445:Olfr356 UTSW 2 36937551 missense probably damaging 0.99
R5096:Olfr356 UTSW 2 36937803 missense possibly damaging 0.64
R5971:Olfr356 UTSW 2 36937229 missense probably benign 0.01
R5988:Olfr356 UTSW 2 36937224 missense probably damaging 1.00
R6138:Olfr356 UTSW 2 36937229 missense probably benign 0.01
R6544:Olfr356 UTSW 2 36937527 missense possibly damaging 0.68
R7206:Olfr356 UTSW 2 36937772 missense probably damaging 1.00
R7752:Olfr356 UTSW 2 36937618 missense probably damaging 0.98
R7854:Olfr356 UTSW 2 36938024 missense probably benign
R8110:Olfr356 UTSW 2 36937709 missense possibly damaging 0.80
U15987:Olfr356 UTSW 2 36937229 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGAAAGTGGAAGACCTTCTCCACCT -3'
(R):5'- AGAGGAACATGTAGCAAGCTCGACT -3'

Sequencing Primer
(F):5'- TGTGGGTCCCATCTCTCAG -3'
(R):5'- catattttgcctttgccactaatc -3'
Posted On2014-05-14