Mutagenetix > Incidental Mutation

Incidental Mutation 'R1689:Supt20'

189554

Institutional Source

Beutler Lab

Gene Symbol

Supt20

Ensembl Gene

ENSMUSG00000027751

Gene Name

suppressor of Ty 20

Synonyms

Fam48a, p38IP, D3Ertd300e, p38 interacting protein

MMRRC Submission

039722-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.927) question?

Stock #

R1689 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

54692807-54728766 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 54712162 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Stop codon at position 355 (L355*)

Ref Sequence

ENSEMBL: ENSMUSP00000143059 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029315] [ENSMUST00000170552] [ENSMUST00000178832] [ENSMUST00000197502] [ENSMUST00000199674] [ENSMUST00000200439] [ENSMUST00000200441]

AlphaFold

Q7TT00

Predicted Effect

probably benign
Transcript: ENSMUST00000029315

SMART Domains

Protein: ENSMUSP00000029315
Gene: ENSMUSG00000027751

Domain	Start	End	E-Value	Type
low complexity region	65	78	N/A	INTRINSIC
low complexity region	107	159	N/A	INTRINSIC
coiled coil region	201	230	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000170552
AA Change: L356*

SMART Domains

Protein: ENSMUSP00000131454
Gene: ENSMUSG00000027751
AA Change: L356*

Domain	Start	End	E-Value	Type
Pfam:Spt20	63	229	6.8e-47	PFAM
low complexity region	425	441	N/A	INTRINSIC
low complexity region	468	477	N/A	INTRINSIC
low complexity region	488	502	N/A	INTRINSIC
low complexity region	515	526	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000178832

Predicted Effect

probably null
Transcript: ENSMUST00000197502
AA Change: L355*

SMART Domains

Protein: ENSMUSP00000143750
Gene: ENSMUSG00000027751
AA Change: L355*

Domain	Start	End	E-Value	Type
low complexity region	45	56	N/A	INTRINSIC
Pfam:Spt20	62	227	1.9e-43	PFAM
low complexity region	424	440	N/A	INTRINSIC
low complexity region	467	476	N/A	INTRINSIC
low complexity region	487	501	N/A	INTRINSIC
low complexity region	512	532	N/A	INTRINSIC
low complexity region	574	587	N/A	INTRINSIC
low complexity region	632	680	N/A	INTRINSIC
coiled coil region	722	751	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000198745

Predicted Effect

probably null
Transcript: ENSMUST00000199674
AA Change: L355*

SMART Domains

Protein: ENSMUSP00000142948
Gene: ENSMUSG00000027751
AA Change: L355*

Domain	Start	End	E-Value	Type
low complexity region	45	56	N/A	INTRINSIC
Pfam:Spt20	59	227	3.3e-39	PFAM
low complexity region	424	442	N/A	INTRINSIC
low complexity region	466	475	N/A	INTRINSIC
low complexity region	486	500	N/A	INTRINSIC
low complexity region	513	524	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000200439
AA Change: L355*

SMART Domains

Protein: ENSMUSP00000143059
Gene: ENSMUSG00000027751
AA Change: L355*

Domain	Start	End	E-Value	Type
low complexity region	45	56	N/A	INTRINSIC
Pfam:Spt20	59	227	2.7e-42	PFAM
low complexity region	424	440	N/A	INTRINSIC
low complexity region	467	476	N/A	INTRINSIC
low complexity region	487	501	N/A	INTRINSIC
low complexity region	514	525	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000200441

SMART Domains

Protein: ENSMUSP00000143231
Gene: ENSMUSG00000027751

Domain	Start	End	E-Value	Type
low complexity region	65	78	N/A	INTRINSIC
low complexity region	123	171	N/A	INTRINSIC
coiled coil region	213	242	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200450

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 93.9%

Validation Efficiency

MGI Phenotype

PHENOTYPE: The incompletely penetrant homozygous phenotype of a splice-site mutation may include retinal epithelium expansion over the dorsal half of the eye, exencephaly, spina bifida, gastrulation defects and/or aberrant somite and mesoderm development. A few mutants survive postnatally and appear normal. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc8	T	C	7: 46,120,403	K896R	probably benign	Het
Adcy9	A	T	16: 4,297,562		probably null	Het
Adgre1	T	C	17: 57,449,921	F726S	probably benign	Het
Ahctf1	A	T	1: 179,768,383	S148T	probably damaging	Het
Aif1	G	A	17: 35,172,151	P44L	probably benign	Het
Ammecr1l	C	A	18: 31,780,688	A289D	probably benign	Het
Amotl1	T	C	9: 14,593,222	Y230C	probably damaging	Het
Armc6	A	T	8: 70,229,537	S65R	probably benign	Het
Atad2b	T	A	12: 5,034,575	Y1440*	probably null	Het
Atf6b	T	A	17: 34,650,302	D164E	probably damaging	Het
B020004J07Rik	T	A	4: 101,837,179	K169I	possibly damaging	Het
B4galt6	C	T	18: 20,706,496	S127N	probably benign	Het
Bcl11a	A	T	11: 24,163,167	Y170F	probably damaging	Het
Bcl11a	A	T	11: 24,164,406	D583V	possibly damaging	Het
Btnl1	T	A	17: 34,381,208	Y228*	probably null	Het
C130060K24Rik	A	G	6: 65,381,607	N105S	possibly damaging	Het
Cav2	A	G	6: 17,281,422	H21R	probably benign	Het
Celsr2	T	A	3: 108,407,304	D1135V	possibly damaging	Het
Cntnap1	A	C	11: 101,188,873		probably null	Het
Cysltr2	T	C	14: 73,030,030	D80G	possibly damaging	Het
Dclk2	C	T	3: 86,805,639	R503Q	possibly damaging	Het
Dgkh	A	T	14: 78,618,544	M363K	possibly damaging	Het
Eml5	C	T	12: 98,830,935	V1112M	probably damaging	Het
Entpd7	A	G	19: 43,725,476	T425A	probably damaging	Het
Ephx2	T	A	14: 66,087,026	K373*	probably null	Het
F5	G	C	1: 164,198,917	R1686P	probably damaging	Het
Fbxw10	A	T	11: 62,860,036	I482L	probably damaging	Het
Fbxw8	T	C	5: 118,077,617	S443G	probably damaging	Het
Fdft1	T	C	14: 63,156,689	E191G	probably benign	Het
Fgd2	A	G	17: 29,363,722	E26G	probably benign	Het
Gabra4	T	C	5: 71,633,542		probably null	Het
Gc	A	G	5: 89,441,200		probably null	Het
Heatr1	T	A	13: 12,424,625	D1361E	probably benign	Het
Hid1	A	G	11: 115,360,357	F118L	probably damaging	Het
Igsf8	G	T	1: 172,318,937	G564W	probably damaging	Het
Il12rb2	A	G	6: 67,336,760	V4A	probably benign	Het
Irak3	T	C	10: 120,146,552	E335G	probably damaging	Het
Itgb8	T	G	12: 119,170,820	Q504P	probably benign	Het
Kbtbd12	A	T	6: 88,618,585	Y88N	probably damaging	Het
Klk1b5	T	C	7: 44,220,545	I226T	probably damaging	Het
L3hypdh	A	T	12: 72,084,753	I135N	probably damaging	Het
Lrp2	G	T	2: 69,503,529	T1456K	probably benign	Het
Mrgprd	C	A	7: 145,321,717	Y108*	probably null	Het
Muc6	C	T	7: 141,647,998	G742D	probably damaging	Het
Nalcn	T	A	14: 123,285,254	I1572F	probably damaging	Het
Nceh1	A	G	3: 27,226,082	Y126C	probably damaging	Het
Olfr125	T	C	17: 37,835,604	S202P	possibly damaging	Het
Olfr356	A	G	2: 36,937,977	N286S	probably damaging	Het
Olfr867	A	T	9: 20,055,126	N112K	possibly damaging	Het
Pacs1	G	T	19: 5,272,615		probably benign	Het
Pappa2	A	G	1: 158,957,398	L14P	probably damaging	Het
Pdlim2	C	T	14: 70,171,239	G176D	probably damaging	Het
Ptpra	T	C	2: 130,503,492	F5L	probably benign	Het
Ralgapa1	A	G	12: 55,676,767	L2114P	possibly damaging	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Senp2	T	A	16: 22,026,666	Y217N	probably damaging	Het
Sned1	C	T	1: 93,283,372	R1061C	probably damaging	Het
Spag16	C	T	1: 70,461,118	T535I	probably benign	Het
Tmem132b	A	G	5: 125,787,614	H928R	possibly damaging	Het
Tpo	A	T	12: 30,098,246	L552H	probably damaging	Het
Tsfm	A	T	10: 127,028,455	N130K	probably damaging	Het
Usp48	T	A	4: 137,656,107		probably null	Het
Vsig10	A	G	5: 117,352,760	D544G	probably benign	Het
Vsig10l	C	T	7: 43,465,368	T433I	possibly damaging	Het
Wdr81	A	G	11: 75,445,596	F1655L	probably damaging	Het
Wfdc3	T	A	2: 164,734,191	D60V	probably damaging	Het

Other mutations in Supt20

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00518:Supt20	APN	3	54715169	missense	probably damaging	0.98
IGL01781:Supt20	APN	3	54695205	start codon destroyed	probably null	0.47
IGL02510:Supt20	APN	3	54715524	intron	probably benign
IGL02656:Supt20	APN	3	54708395	missense	probably damaging	1.00
IGL02958:Supt20	APN	3	54713723	intron	probably benign
IGL03036:Supt20	APN	3	54709302	nonsense	probably null
IGL03128:Supt20	APN	3	54708287	missense	probably benign	0.05
IGL03164:Supt20	APN	3	54713188	missense	probably benign	0.01
FR4304:Supt20	UTSW	3	54727647	small insertion	probably benign
FR4304:Supt20	UTSW	3	54727662	small insertion	probably benign
FR4304:Supt20	UTSW	3	54727664	nonsense	probably null
FR4449:Supt20	UTSW	3	54727649	small insertion	probably benign
FR4548:Supt20	UTSW	3	54727657	small insertion	probably benign
FR4548:Supt20	UTSW	3	54727664	small insertion	probably benign
FR4548:Supt20	UTSW	3	54727673	small insertion	probably benign
FR4589:Supt20	UTSW	3	54727651	small insertion	probably benign
FR4589:Supt20	UTSW	3	54727655	small insertion	probably benign
FR4589:Supt20	UTSW	3	54727671	small insertion	probably benign
FR4737:Supt20	UTSW	3	54727657	small insertion	probably benign
FR4737:Supt20	UTSW	3	54727658	small insertion	probably benign
FR4737:Supt20	UTSW	3	54727661	small insertion	probably benign
R0383:Supt20	UTSW	3	54703149	nonsense	probably null
R0675:Supt20	UTSW	3	54706969	missense	probably damaging	1.00
R0744:Supt20	UTSW	3	54714701	missense	probably damaging	1.00
R0968:Supt20	UTSW	3	54708400	intron	probably benign
R1075:Supt20	UTSW	3	54706941	nonsense	probably null
R1772:Supt20	UTSW	3	54710420	missense	probably damaging	1.00
R1779:Supt20	UTSW	3	54714743	missense	probably benign	0.00
R1829:Supt20	UTSW	3	54727658	utr 3 prime	probably benign
R3236:Supt20	UTSW	3	54709080	missense	possibly damaging	0.94
R3237:Supt20	UTSW	3	54709080	missense	possibly damaging	0.94
R4989:Supt20	UTSW	3	54695134	utr 5 prime	probably benign
R5180:Supt20	UTSW	3	54709085	missense	probably benign	0.00
R5188:Supt20	UTSW	3	54710428	missense	possibly damaging	0.87
R5423:Supt20	UTSW	3	54709325	missense	probably damaging	1.00
R5627:Supt20	UTSW	3	54713190	missense	possibly damaging	0.86
R5888:Supt20	UTSW	3	54712207	missense	probably benign
R5995:Supt20	UTSW	3	54709053	missense	probably damaging	0.97
R6316:Supt20	UTSW	3	54727648	small insertion	probably benign
R6623:Supt20	UTSW	3	54718294	missense	possibly damaging	0.93
R6713:Supt20	UTSW	3	54698601	missense	possibly damaging	0.89
R6874:Supt20	UTSW	3	54727754	splice site	probably null
R6988:Supt20	UTSW	3	54698597	missense	probably damaging	1.00
R7149:Supt20	UTSW	3	54728411	missense	unknown
R7592:Supt20	UTSW	3	54707122	missense	probably damaging	0.97
R7940:Supt20	UTSW	3	54713199	missense	probably benign	0.04
R8480:Supt20	UTSW	3	54707116	missense	probably damaging	1.00
R8550:Supt20	UTSW	3	54715642	missense	possibly damaging	0.48
R8935:Supt20	UTSW	3	54727567	critical splice acceptor site	probably null
R9412:Supt20	UTSW	3	54727648	small deletion	probably benign
R9414:Supt20	UTSW	3	54703083	missense	probably damaging	1.00
R9694:Supt20	UTSW	3	54715594	missense	probably benign	0.02
RF001:Supt20	UTSW	3	54727662	small insertion	probably benign
RF009:Supt20	UTSW	3	54727662	small insertion	probably benign
RF010:Supt20	UTSW	3	54727662	small insertion	probably benign
RF014:Supt20	UTSW	3	54727665	small insertion	probably benign
RF026:Supt20	UTSW	3	54727647	small insertion	probably benign
RF026:Supt20	UTSW	3	54727670	nonsense	probably null
RF032:Supt20	UTSW	3	54727666	small insertion	probably benign
RF038:Supt20	UTSW	3	54727647	small insertion	probably benign
RF045:Supt20	UTSW	3	54727666	small insertion	probably benign
RF052:Supt20	UTSW	3	54727665	small insertion	probably benign

Predicted Primers

PCR Primer
(F):5'- TGTTAAGTGCTGTGACAATGTCCAGTC -3'
(R):5'- TAGCAAGCAGCTCCTTGGTAGCTC -3'

Sequencing Primer
(F):5'- CCTTTAGTGCCATGTATATAGCAGAC -3'
(R):5'- ACTGGGATGGAGACATTTGG -3'

Posted On

2014-05-14