Incidental Mutation 'R1689:Klk1b5'
ID189571
Institutional Source Beutler Lab
Gene Symbol Klk1b5
Ensembl Gene ENSMUSG00000066512
Gene Namekallikrein 1-related peptidase b5
SynonymsmGK-5, Klk5
MMRRC Submission 039722-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.043) question?
Stock #R1689 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location44215945-44220703 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 44220545 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 226 (I226T)
Ref Sequence ENSEMBL: ENSMUSP00000073964 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074359] [ENSMUST00000075162] [ENSMUST00000206144]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000072123
SMART Domains Protein: ENSMUSP00000071992
Gene: ENSMUSG00000062073

DomainStartEndE-ValueType
transmembrane domain 32 49 N/A INTRINSIC
transmembrane domain 62 84 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000074359
AA Change: I226T

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000073964
Gene: ENSMUSG00000066512
AA Change: I226T

DomainStartEndE-ValueType
Tryp_SPc 24 253 1.49e-100 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000075162
SMART Domains Protein: ENSMUSP00000074659
Gene: ENSMUSG00000063903

DomainStartEndE-ValueType
Tryp_SPc 24 253 7.26e-104 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205329
Predicted Effect probably benign
Transcript: ENSMUST00000206144
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206890
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the kallikrein subfamily of serine proteases that are involved in diverse physiological functions such as skin desquamation, tooth enamel formation, seminal liquefaction, synaptic neural plasticity and brain function. The encoded preproprotein undergoes proteolytic cleavage of the activation peptide to generate the functional enzyme. This gene is located in a cluster of several related kallikrein genes on chromosome 7. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 T C 7: 46,120,403 K896R probably benign Het
Adcy9 A T 16: 4,297,562 probably null Het
Adgre1 T C 17: 57,449,921 F726S probably benign Het
Ahctf1 A T 1: 179,768,383 S148T probably damaging Het
Aif1 G A 17: 35,172,151 P44L probably benign Het
Ammecr1l C A 18: 31,780,688 A289D probably benign Het
Amotl1 T C 9: 14,593,222 Y230C probably damaging Het
Armc6 A T 8: 70,229,537 S65R probably benign Het
Atad2b T A 12: 5,034,575 Y1440* probably null Het
Atf6b T A 17: 34,650,302 D164E probably damaging Het
B020004J07Rik T A 4: 101,837,179 K169I possibly damaging Het
B4galt6 C T 18: 20,706,496 S127N probably benign Het
Bcl11a A T 11: 24,164,406 D583V possibly damaging Het
Bcl11a A T 11: 24,163,167 Y170F probably damaging Het
Btnl1 T A 17: 34,381,208 Y228* probably null Het
C130060K24Rik A G 6: 65,381,607 N105S possibly damaging Het
Cav2 A G 6: 17,281,422 H21R probably benign Het
Celsr2 T A 3: 108,407,304 D1135V possibly damaging Het
Cntnap1 A C 11: 101,188,873 probably null Het
Cysltr2 T C 14: 73,030,030 D80G possibly damaging Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Dgkh A T 14: 78,618,544 M363K possibly damaging Het
Eml5 C T 12: 98,830,935 V1112M probably damaging Het
Entpd7 A G 19: 43,725,476 T425A probably damaging Het
Ephx2 T A 14: 66,087,026 K373* probably null Het
F5 G C 1: 164,198,917 R1686P probably damaging Het
Fbxw10 A T 11: 62,860,036 I482L probably damaging Het
Fbxw8 T C 5: 118,077,617 S443G probably damaging Het
Fdft1 T C 14: 63,156,689 E191G probably benign Het
Fgd2 A G 17: 29,363,722 E26G probably benign Het
Gabra4 T C 5: 71,633,542 probably null Het
Gc A G 5: 89,441,200 probably null Het
Heatr1 T A 13: 12,424,625 D1361E probably benign Het
Hid1 A G 11: 115,360,357 F118L probably damaging Het
Igsf8 G T 1: 172,318,937 G564W probably damaging Het
Il12rb2 A G 6: 67,336,760 V4A probably benign Het
Irak3 T C 10: 120,146,552 E335G probably damaging Het
Itgb8 T G 12: 119,170,820 Q504P probably benign Het
Kbtbd12 A T 6: 88,618,585 Y88N probably damaging Het
L3hypdh A T 12: 72,084,753 I135N probably damaging Het
Lrp2 G T 2: 69,503,529 T1456K probably benign Het
Mrgprd C A 7: 145,321,717 Y108* probably null Het
Muc6 C T 7: 141,647,998 G742D probably damaging Het
Nalcn T A 14: 123,285,254 I1572F probably damaging Het
Nceh1 A G 3: 27,226,082 Y126C probably damaging Het
Olfr125 T C 17: 37,835,604 S202P possibly damaging Het
Olfr356 A G 2: 36,937,977 N286S probably damaging Het
Olfr867 A T 9: 20,055,126 N112K possibly damaging Het
Pacs1 G T 19: 5,272,615 probably benign Het
Pappa2 A G 1: 158,957,398 L14P probably damaging Het
Pdlim2 C T 14: 70,171,239 G176D probably damaging Het
Ptpra T C 2: 130,503,492 F5L probably benign Het
Ralgapa1 A G 12: 55,676,767 L2114P possibly damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Senp2 T A 16: 22,026,666 Y217N probably damaging Het
Sned1 C T 1: 93,283,372 R1061C probably damaging Het
Spag16 C T 1: 70,461,118 T535I probably benign Het
Supt20 T A 3: 54,712,162 L355* probably null Het
Tmem132b A G 5: 125,787,614 H928R possibly damaging Het
Tpo A T 12: 30,098,246 L552H probably damaging Het
Tsfm A T 10: 127,028,455 N130K probably damaging Het
Usp48 T A 4: 137,656,107 probably null Het
Vsig10 A G 5: 117,352,760 D544G probably benign Het
Vsig10l C T 7: 43,465,368 T433I possibly damaging Het
Wdr81 A G 11: 75,445,596 F1655L probably damaging Het
Wfdc3 T A 2: 164,734,191 D60V probably damaging Het
Other mutations in Klk1b5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Klk1b5 APN 7 44216504 missense probably benign 0.00
R0515:Klk1b5 UTSW 7 44218533 missense probably damaging 1.00
R0706:Klk1b5 UTSW 7 44218514 missense probably damaging 1.00
R1845:Klk1b5 UTSW 7 44220125 missense probably benign
R2153:Klk1b5 UTSW 7 44219898 critical splice donor site probably null
R8264:Klk1b5 UTSW 7 44220030 missense probably damaging 1.00
R8402:Klk1b5 UTSW 7 44218538 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGGAACAGATGGCCTCCTAAGAGC -3'
(R):5'- TGACAGGGTACTGCACACCAGAAG -3'

Sequencing Primer
(F):5'- CTAAGAGCTGGATTCCCTCAC -3'
(R):5'- CCAGAGAATGTCAGAACTTGAACTC -3'
Posted On2014-05-14