Incidental Mutation 'R1689:Bcl11a'
ID189583
Institutional Source Beutler Lab
Gene Symbol Bcl11a
Ensembl Gene ENSMUSG00000000861
Gene NameB cell CLL/lymphoma 11A (zinc finger protein)
Synonyms2810047E18Rik, Evi9c, Evi9, Evi9b, Evi9a, COUP-TF interacting protein 1, D930021L15Rik, CTIP1, mouse myeloid leukemia gene
MMRRC Submission 039722-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1689 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location24078056-24174123 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 24164406 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 583 (D583V)
Ref Sequence ENSEMBL: ENSMUSP00000105140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000881] [ENSMUST00000109514] [ENSMUST00000109516] [ENSMUST00000118955]
Predicted Effect possibly damaging
Transcript: ENSMUST00000000881
AA Change: D583V

PolyPhen 2 Score 0.574 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000000881
Gene: ENSMUSG00000000861
AA Change: D583V

DomainStartEndE-ValueType
Pfam:zf-C2H2_6 45 73 5.9e-9 PFAM
ZnF_C2H2 170 193 7.15e-2 SMART
low complexity region 258 274 N/A INTRINSIC
low complexity region 327 338 N/A INTRINSIC
low complexity region 352 373 N/A INTRINSIC
ZnF_C2H2 377 399 6.23e-2 SMART
ZnF_C2H2 405 427 1.69e-3 SMART
low complexity region 456 472 N/A INTRINSIC
coiled coil region 481 513 N/A INTRINSIC
low complexity region 614 634 N/A INTRINSIC
low complexity region 682 696 N/A INTRINSIC
low complexity region 708 731 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109514
AA Change: D583V

PolyPhen 2 Score 0.660 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000105140
Gene: ENSMUSG00000000861
AA Change: D583V

DomainStartEndE-ValueType
Blast:ZnF_C2H2 46 72 8e-10 BLAST
ZnF_C2H2 170 193 7.15e-2 SMART
low complexity region 258 274 N/A INTRINSIC
low complexity region 327 338 N/A INTRINSIC
low complexity region 352 373 N/A INTRINSIC
ZnF_C2H2 377 399 6.23e-2 SMART
ZnF_C2H2 405 427 1.69e-3 SMART
low complexity region 456 472 N/A INTRINSIC
coiled coil region 481 513 N/A INTRINSIC
low complexity region 614 634 N/A INTRINSIC
low complexity region 682 696 N/A INTRINSIC
low complexity region 708 731 N/A INTRINSIC
ZnF_C2H2 742 764 1.41e0 SMART
ZnF_C2H2 770 792 4.24e-4 SMART
ZnF_C2H2 800 823 3.07e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109516
SMART Domains Protein: ENSMUSP00000105142
Gene: ENSMUSG00000000861

DomainStartEndE-ValueType
Pfam:zf-C2H2_6 45 73 3.2e-8 PFAM
ZnF_C2H2 170 193 7.15e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118955
SMART Domains Protein: ENSMUSP00000112948
Gene: ENSMUSG00000000861

DomainStartEndE-ValueType
ZnF_C2H2 118 141 7.15e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127494
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131383
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146717
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a C2H2 type zinc-finger protein by its similarity to the mouse Bcl11a/Evi9 protein. The corresponding mouse gene is a common site of retroviral integration in myeloid leukemia, and may function as a leukemia disease gene, in part, through its interaction with BCL6. During hematopoietic cell differentiation, this gene is down-regulated. It is possibly involved in lymphoma pathogenesis since translocations associated with B-cell malignancies also deregulates its expression. Multiple transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in B cell deficiency, alteration of T cell types, and neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 T C 7: 46,120,403 K896R probably benign Het
Adcy9 A T 16: 4,297,562 probably null Het
Adgre1 T C 17: 57,449,921 F726S probably benign Het
Ahctf1 A T 1: 179,768,383 S148T probably damaging Het
Aif1 G A 17: 35,172,151 P44L probably benign Het
Ammecr1l C A 18: 31,780,688 A289D probably benign Het
Amotl1 T C 9: 14,593,222 Y230C probably damaging Het
Armc6 A T 8: 70,229,537 S65R probably benign Het
Atad2b T A 12: 5,034,575 Y1440* probably null Het
Atf6b T A 17: 34,650,302 D164E probably damaging Het
B020004J07Rik T A 4: 101,837,179 K169I possibly damaging Het
B4galt6 C T 18: 20,706,496 S127N probably benign Het
Btnl1 T A 17: 34,381,208 Y228* probably null Het
C130060K24Rik A G 6: 65,381,607 N105S possibly damaging Het
Cav2 A G 6: 17,281,422 H21R probably benign Het
Celsr2 T A 3: 108,407,304 D1135V possibly damaging Het
Cntnap1 A C 11: 101,188,873 probably null Het
Cysltr2 T C 14: 73,030,030 D80G possibly damaging Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Dgkh A T 14: 78,618,544 M363K possibly damaging Het
Eml5 C T 12: 98,830,935 V1112M probably damaging Het
Entpd7 A G 19: 43,725,476 T425A probably damaging Het
Ephx2 T A 14: 66,087,026 K373* probably null Het
F5 G C 1: 164,198,917 R1686P probably damaging Het
Fbxw10 A T 11: 62,860,036 I482L probably damaging Het
Fbxw8 T C 5: 118,077,617 S443G probably damaging Het
Fdft1 T C 14: 63,156,689 E191G probably benign Het
Fgd2 A G 17: 29,363,722 E26G probably benign Het
Gabra4 T C 5: 71,633,542 probably null Het
Gc A G 5: 89,441,200 probably null Het
Heatr1 T A 13: 12,424,625 D1361E probably benign Het
Hid1 A G 11: 115,360,357 F118L probably damaging Het
Igsf8 G T 1: 172,318,937 G564W probably damaging Het
Il12rb2 A G 6: 67,336,760 V4A probably benign Het
Irak3 T C 10: 120,146,552 E335G probably damaging Het
Itgb8 T G 12: 119,170,820 Q504P probably benign Het
Kbtbd12 A T 6: 88,618,585 Y88N probably damaging Het
Klk1b5 T C 7: 44,220,545 I226T probably damaging Het
L3hypdh A T 12: 72,084,753 I135N probably damaging Het
Lrp2 G T 2: 69,503,529 T1456K probably benign Het
Mrgprd C A 7: 145,321,717 Y108* probably null Het
Muc6 C T 7: 141,647,998 G742D probably damaging Het
Nalcn T A 14: 123,285,254 I1572F probably damaging Het
Nceh1 A G 3: 27,226,082 Y126C probably damaging Het
Olfr125 T C 17: 37,835,604 S202P possibly damaging Het
Olfr356 A G 2: 36,937,977 N286S probably damaging Het
Olfr867 A T 9: 20,055,126 N112K possibly damaging Het
Pacs1 G T 19: 5,272,615 probably benign Het
Pappa2 A G 1: 158,957,398 L14P probably damaging Het
Pdlim2 C T 14: 70,171,239 G176D probably damaging Het
Ptpra T C 2: 130,503,492 F5L probably benign Het
Ralgapa1 A G 12: 55,676,767 L2114P possibly damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Senp2 T A 16: 22,026,666 Y217N probably damaging Het
Sned1 C T 1: 93,283,372 R1061C probably damaging Het
Spag16 C T 1: 70,461,118 T535I probably benign Het
Supt20 T A 3: 54,712,162 L355* probably null Het
Tmem132b A G 5: 125,787,614 H928R possibly damaging Het
Tpo A T 12: 30,098,246 L552H probably damaging Het
Tsfm A T 10: 127,028,455 N130K probably damaging Het
Usp48 T A 4: 137,656,107 probably null Het
Vsig10 A G 5: 117,352,760 D544G probably benign Het
Vsig10l C T 7: 43,465,368 T433I possibly damaging Het
Wdr81 A G 11: 75,445,596 F1655L probably damaging Het
Wfdc3 T A 2: 164,734,191 D60V probably damaging Het
Other mutations in Bcl11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Bcl11a APN 11 24163346 missense probably benign 0.00
IGL03190:Bcl11a APN 11 24158333 missense probably benign 0.00
R0317:Bcl11a UTSW 11 24172697 critical splice acceptor site probably null
R1061:Bcl11a UTSW 11 24164069 nonsense probably null
R1124:Bcl11a UTSW 11 24163928 missense probably damaging 1.00
R1163:Bcl11a UTSW 11 24165143 missense probably benign 0.41
R1498:Bcl11a UTSW 11 24164005 missense probably damaging 1.00
R1599:Bcl11a UTSW 11 24163887 missense probably damaging 1.00
R1689:Bcl11a UTSW 11 24163167 missense probably damaging 1.00
R1754:Bcl11a UTSW 11 24164724 missense probably damaging 1.00
R2036:Bcl11a UTSW 11 24164087 missense possibly damaging 0.71
R2207:Bcl11a UTSW 11 24163343 missense probably damaging 1.00
R3700:Bcl11a UTSW 11 24163890 missense probably damaging 1.00
R3779:Bcl11a UTSW 11 24164568 missense probably damaging 1.00
R4557:Bcl11a UTSW 11 24164004 missense probably damaging 1.00
R4703:Bcl11a UTSW 11 24163725 missense possibly damaging 0.80
R5006:Bcl11a UTSW 11 24164989 nonsense probably null
R5053:Bcl11a UTSW 11 24164068 missense probably benign 0.03
R5495:Bcl11a UTSW 11 24165042 missense possibly damaging 0.73
R5581:Bcl11a UTSW 11 24163932 missense probably damaging 1.00
R5680:Bcl11a UTSW 11 24164264 missense possibly damaging 0.52
R5790:Bcl11a UTSW 11 24163650 missense probably damaging 1.00
R6291:Bcl11a UTSW 11 24158321 missense probably damaging 0.96
R6723:Bcl11a UTSW 11 24163646 missense probably damaging 1.00
R7116:Bcl11a UTSW 11 24163839 missense probably damaging 1.00
R7274:Bcl11a UTSW 11 24163985 missense probably damaging 1.00
R7569:Bcl11a UTSW 11 24085458 nonsense probably null
R7843:Bcl11a UTSW 11 24164831 missense probably benign 0.26
R7923:Bcl11a UTSW 11 24163680 missense probably damaging 1.00
R7964:Bcl11a UTSW 11 24163353 missense probably benign 0.28
R8242:Bcl11a UTSW 11 24163208 missense probably benign 0.14
R8338:Bcl11a UTSW 11 24164578 missense probably damaging 1.00
Z1176:Bcl11a UTSW 11 24165010 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAGTTCAAGAGTGAGAACGACCCC -3'
(R):5'- AGCTTGATGCGCTTGGAGAAGG -3'

Sequencing Primer
(F):5'- gaggaagaagaagaagaggagg -3'
(R):5'- CTTGGAGAAGGGGCTCAGC -3'
Posted On2014-05-14