Incidental Mutation 'R1689:Fbxw10'
ID189584
Institutional Source Beutler Lab
Gene Symbol Fbxw10
Ensembl Gene ENSMUSG00000090173
Gene NameF-box and WD-40 domain protein 10
SynonymsSM2SH2, SM25H2, Fbw10
MMRRC Submission 039722-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R1689 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location62847069-62877465 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 62860036 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 482 (I482L)
Ref Sequence ENSEMBL: ENSMUSP00000135294 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036085] [ENSMUST00000150989] [ENSMUST00000176577] [ENSMUST00000177336]
Predicted Effect probably damaging
Transcript: ENSMUST00000036085
AA Change: I492L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000046156
Gene: ENSMUSG00000090173
AA Change: I492L

DomainStartEndE-ValueType
low complexity region 262 274 N/A INTRINSIC
Blast:FBOX 286 326 6e-14 BLAST
Blast:WD40 416 453 2e-8 BLAST
WD40 457 496 1.78e-5 SMART
WD40 499 536 5.55e-7 SMART
WD40 539 575 2.84e-4 SMART
WD40 578 615 3.81e-5 SMART
WD40 620 656 6.9e-1 SMART
low complexity region 709 724 N/A INTRINSIC
coiled coil region 964 992 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000150989
AA Change: I482L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000117872
Gene: ENSMUSG00000090173
AA Change: I482L

DomainStartEndE-ValueType
low complexity region 262 274 N/A INTRINSIC
Blast:FBOX 286 326 1e-13 BLAST
Blast:WD40 406 443 2e-8 BLAST
WD40 447 486 1.78e-5 SMART
WD40 489 526 5.55e-7 SMART
WD40 529 565 2.84e-4 SMART
WD40 568 605 3.81e-5 SMART
WD40 610 646 6.9e-1 SMART
low complexity region 699 714 N/A INTRINSIC
coiled coil region 954 982 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176577
AA Change: I482L

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000135870
Gene: ENSMUSG00000090173
AA Change: I482L

DomainStartEndE-ValueType
low complexity region 262 274 N/A INTRINSIC
Blast:FBOX 286 326 6e-14 BLAST
Blast:WD40 406 443 2e-8 BLAST
WD40 447 486 1.78e-5 SMART
WD40 489 526 5.55e-7 SMART
WD40 529 565 2.84e-4 SMART
WD40 568 605 3.81e-5 SMART
WD40 610 646 6.9e-1 SMART
low complexity region 704 719 N/A INTRINSIC
coiled coil region 959 987 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000177336
AA Change: I482L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135294
Gene: ENSMUSG00000090173
AA Change: I482L

DomainStartEndE-ValueType
low complexity region 262 274 N/A INTRINSIC
Blast:FBOX 286 326 5e-14 BLAST
Blast:WD40 406 443 1e-8 BLAST
WD40 447 486 1.78e-5 SMART
WD40 489 526 5.55e-7 SMART
WD40 529 565 2.84e-4 SMART
WD40 568 605 3.81e-5 SMART
WD40 610 646 6.9e-1 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the F-box protein family, such as FBXW10, are characterized by an approximately 40-amino acid F-box motif. SCF complexes, formed by SKP1 (MIM 601434), cullin (see CUL1; MIM 603134), and F-box proteins, act as protein-ubiquitin ligases. F-box proteins interact with SKP1 through the F box, and they interact with ubiquitination targets through other protein interaction domains (Jin et al., 2004 [PubMed 15520277]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 T C 7: 46,120,403 K896R probably benign Het
Adcy9 A T 16: 4,297,562 probably null Het
Adgre1 T C 17: 57,449,921 F726S probably benign Het
Ahctf1 A T 1: 179,768,383 S148T probably damaging Het
Aif1 G A 17: 35,172,151 P44L probably benign Het
Ammecr1l C A 18: 31,780,688 A289D probably benign Het
Amotl1 T C 9: 14,593,222 Y230C probably damaging Het
Armc6 A T 8: 70,229,537 S65R probably benign Het
Atad2b T A 12: 5,034,575 Y1440* probably null Het
Atf6b T A 17: 34,650,302 D164E probably damaging Het
B020004J07Rik T A 4: 101,837,179 K169I possibly damaging Het
B4galt6 C T 18: 20,706,496 S127N probably benign Het
Bcl11a A T 11: 24,164,406 D583V possibly damaging Het
Bcl11a A T 11: 24,163,167 Y170F probably damaging Het
Btnl1 T A 17: 34,381,208 Y228* probably null Het
C130060K24Rik A G 6: 65,381,607 N105S possibly damaging Het
Cav2 A G 6: 17,281,422 H21R probably benign Het
Celsr2 T A 3: 108,407,304 D1135V possibly damaging Het
Cntnap1 A C 11: 101,188,873 probably null Het
Cysltr2 T C 14: 73,030,030 D80G possibly damaging Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Dgkh A T 14: 78,618,544 M363K possibly damaging Het
Eml5 C T 12: 98,830,935 V1112M probably damaging Het
Entpd7 A G 19: 43,725,476 T425A probably damaging Het
Ephx2 T A 14: 66,087,026 K373* probably null Het
F5 G C 1: 164,198,917 R1686P probably damaging Het
Fbxw8 T C 5: 118,077,617 S443G probably damaging Het
Fdft1 T C 14: 63,156,689 E191G probably benign Het
Fgd2 A G 17: 29,363,722 E26G probably benign Het
Gabra4 T C 5: 71,633,542 probably null Het
Gc A G 5: 89,441,200 probably null Het
Heatr1 T A 13: 12,424,625 D1361E probably benign Het
Hid1 A G 11: 115,360,357 F118L probably damaging Het
Igsf8 G T 1: 172,318,937 G564W probably damaging Het
Il12rb2 A G 6: 67,336,760 V4A probably benign Het
Irak3 T C 10: 120,146,552 E335G probably damaging Het
Itgb8 T G 12: 119,170,820 Q504P probably benign Het
Kbtbd12 A T 6: 88,618,585 Y88N probably damaging Het
Klk1b5 T C 7: 44,220,545 I226T probably damaging Het
L3hypdh A T 12: 72,084,753 I135N probably damaging Het
Lrp2 G T 2: 69,503,529 T1456K probably benign Het
Mrgprd C A 7: 145,321,717 Y108* probably null Het
Muc6 C T 7: 141,647,998 G742D probably damaging Het
Nalcn T A 14: 123,285,254 I1572F probably damaging Het
Nceh1 A G 3: 27,226,082 Y126C probably damaging Het
Olfr125 T C 17: 37,835,604 S202P possibly damaging Het
Olfr356 A G 2: 36,937,977 N286S probably damaging Het
Olfr867 A T 9: 20,055,126 N112K possibly damaging Het
Pacs1 G T 19: 5,272,615 probably benign Het
Pappa2 A G 1: 158,957,398 L14P probably damaging Het
Pdlim2 C T 14: 70,171,239 G176D probably damaging Het
Ptpra T C 2: 130,503,492 F5L probably benign Het
Ralgapa1 A G 12: 55,676,767 L2114P possibly damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Senp2 T A 16: 22,026,666 Y217N probably damaging Het
Sned1 C T 1: 93,283,372 R1061C probably damaging Het
Spag16 C T 1: 70,461,118 T535I probably benign Het
Supt20 T A 3: 54,712,162 L355* probably null Het
Tmem132b A G 5: 125,787,614 H928R possibly damaging Het
Tpo A T 12: 30,098,246 L552H probably damaging Het
Tsfm A T 10: 127,028,455 N130K probably damaging Het
Usp48 T A 4: 137,656,107 probably null Het
Vsig10 A G 5: 117,352,760 D544G probably benign Het
Vsig10l C T 7: 43,465,368 T433I possibly damaging Het
Wdr81 A G 11: 75,445,596 F1655L probably damaging Het
Wfdc3 T A 2: 164,734,191 D60V probably damaging Het
Other mutations in Fbxw10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00941:Fbxw10 APN 11 62873501 missense probably damaging 1.00
IGL01552:Fbxw10 APN 11 62857684 critical splice acceptor site probably null
IGL01625:Fbxw10 APN 11 62860027 missense probably damaging 1.00
IGL01960:Fbxw10 APN 11 62876756 missense probably damaging 1.00
IGL02457:Fbxw10 APN 11 62874982 missense probably damaging 1.00
IGL02475:Fbxw10 APN 11 62857735 missense possibly damaging 0.94
IGL02864:Fbxw10 APN 11 62873523 missense probably damaging 1.00
R0083:Fbxw10 UTSW 11 62877061 missense probably benign 0.00
R0108:Fbxw10 UTSW 11 62877061 missense probably benign 0.00
R0147:Fbxw10 UTSW 11 62847481 splice site probably null
R0180:Fbxw10 UTSW 11 62853096 missense probably benign 0.09
R0196:Fbxw10 UTSW 11 62877244 missense probably benign 0.01
R0454:Fbxw10 UTSW 11 62876738 missense possibly damaging 0.53
R0529:Fbxw10 UTSW 11 62859845 missense probably damaging 1.00
R0791:Fbxw10 UTSW 11 62847456 missense probably benign 0.18
R0927:Fbxw10 UTSW 11 62876944 missense probably damaging 0.98
R1026:Fbxw10 UTSW 11 62875171 missense probably benign
R1448:Fbxw10 UTSW 11 62847592 missense possibly damaging 0.74
R1468:Fbxw10 UTSW 11 62862638 missense probably damaging 1.00
R1468:Fbxw10 UTSW 11 62862638 missense probably damaging 1.00
R1785:Fbxw10 UTSW 11 62859857 missense probably damaging 0.99
R2130:Fbxw10 UTSW 11 62859857 missense probably damaging 0.99
R2132:Fbxw10 UTSW 11 62859857 missense probably damaging 0.99
R2211:Fbxw10 UTSW 11 62867535 missense probably damaging 0.99
R3078:Fbxw10 UTSW 11 62867513 splice site probably benign
R3700:Fbxw10 UTSW 11 62869157 splice site probably null
R3932:Fbxw10 UTSW 11 62869157 splice site probably benign
R4843:Fbxw10 UTSW 11 62847325 missense possibly damaging 0.95
R4869:Fbxw10 UTSW 11 62862731 missense probably damaging 0.98
R4879:Fbxw10 UTSW 11 62847747 missense probably damaging 0.99
R4980:Fbxw10 UTSW 11 62847757 missense possibly damaging 0.94
R5417:Fbxw10 UTSW 11 62877164 missense possibly damaging 0.53
R5531:Fbxw10 UTSW 11 62862656 missense probably damaging 1.00
R5877:Fbxw10 UTSW 11 62857716 missense probably damaging 1.00
R6028:Fbxw10 UTSW 11 62873519 nonsense probably null
R6616:Fbxw10 UTSW 11 62853024 missense probably benign 0.14
R6870:Fbxw10 UTSW 11 62855367 missense probably damaging 0.99
R6967:Fbxw10 UTSW 11 62847603 missense possibly damaging 0.73
R7409:Fbxw10 UTSW 11 62876780 missense possibly damaging 0.86
R7464:Fbxw10 UTSW 11 62853298 missense probably benign 0.01
R7542:Fbxw10 UTSW 11 62850596 missense probably benign 0.33
R7568:Fbxw10 UTSW 11 62875168 missense probably benign
R7733:Fbxw10 UTSW 11 62873397 missense unknown
R7793:Fbxw10 UTSW 11 62847387 missense possibly damaging 0.96
R7943:Fbxw10 UTSW 11 62850661 nonsense probably null
R8003:Fbxw10 UTSW 11 62857761 missense possibly damaging 0.53
R8323:Fbxw10 UTSW 11 62876680 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- GCACTGAATTTCGTATTACTCCACCGC -3'
(R):5'- CTGATTTTCAATGCCGACATCTGATAGC -3'

Sequencing Primer
(F):5'- TCCTGAAACCCAGGTTTGAC -3'
(R):5'- GCTTGTATCTTGCAAAAAGAACCC -3'
Posted On2014-05-14