Mutagenetix > Incidental Mutation

Incidental Mutation 'R1689:Atad2b'

189588

Institutional Source

Beutler Lab

Gene Symbol

Atad2b

Ensembl Gene

ENSMUSG00000052812

Gene Name

ATPase family, AAA domain containing 2B

Synonyms

D530031C13Rik, 1110014E10Rik

MMRRC Submission

039722-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1689 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

4917353-5047394 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 5034575 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 1440 (Y1440*)

Ref Sequence

ENSEMBL: ENSMUSP00000047445 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045664]

AlphaFold

E9Q166

Predicted Effect

probably null
Transcript: ENSMUST00000045664
AA Change: Y1440*

SMART Domains

Protein: ENSMUSP00000047445
Gene: ENSMUSG00000052812
AA Change: Y1440*

Domain	Start	End	E-Value	Type
low complexity region	13	54	N/A	INTRINSIC
low complexity region	135	146	N/A	INTRINSIC
low complexity region	231	242	N/A	INTRINSIC
low complexity region	252	278	N/A	INTRINSIC
AAA	432	573	4.56e-20	SMART
SCOP:d1e32a2	771	912	3e-4	SMART
BROMO	958	1070	4.24e-20	SMART
low complexity region	1135	1144	N/A	INTRINSIC
low complexity region	1230	1253	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 93.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the AAA ATPase family. This family member includes an N-terminal bromodomain. It has been found to be localized to the nucleus, partly to replication sites, consistent with a chromatin-related function. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit reduced body size and fertility in female mice. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc8	T	C	7: 46,120,403	K896R	probably benign	Het
Adcy9	A	T	16: 4,297,562		probably null	Het
Adgre1	T	C	17: 57,449,921	F726S	probably benign	Het
Ahctf1	A	T	1: 179,768,383	S148T	probably damaging	Het
Aif1	G	A	17: 35,172,151	P44L	probably benign	Het
Ammecr1l	C	A	18: 31,780,688	A289D	probably benign	Het
Amotl1	T	C	9: 14,593,222	Y230C	probably damaging	Het
Armc6	A	T	8: 70,229,537	S65R	probably benign	Het
Atf6b	T	A	17: 34,650,302	D164E	probably damaging	Het
B020004J07Rik	T	A	4: 101,837,179	K169I	possibly damaging	Het
B4galt6	C	T	18: 20,706,496	S127N	probably benign	Het
Bcl11a	A	T	11: 24,163,167	Y170F	probably damaging	Het
Bcl11a	A	T	11: 24,164,406	D583V	possibly damaging	Het
Btnl1	T	A	17: 34,381,208	Y228*	probably null	Het
C130060K24Rik	A	G	6: 65,381,607	N105S	possibly damaging	Het
Cav2	A	G	6: 17,281,422	H21R	probably benign	Het
Celsr2	T	A	3: 108,407,304	D1135V	possibly damaging	Het
Cntnap1	A	C	11: 101,188,873		probably null	Het
Cysltr2	T	C	14: 73,030,030	D80G	possibly damaging	Het
Dclk2	C	T	3: 86,805,639	R503Q	possibly damaging	Het
Dgkh	A	T	14: 78,618,544	M363K	possibly damaging	Het
Eml5	C	T	12: 98,830,935	V1112M	probably damaging	Het
Entpd7	A	G	19: 43,725,476	T425A	probably damaging	Het
Ephx2	T	A	14: 66,087,026	K373*	probably null	Het
F5	G	C	1: 164,198,917	R1686P	probably damaging	Het
Fbxw10	A	T	11: 62,860,036	I482L	probably damaging	Het
Fbxw8	T	C	5: 118,077,617	S443G	probably damaging	Het
Fdft1	T	C	14: 63,156,689	E191G	probably benign	Het
Fgd2	A	G	17: 29,363,722	E26G	probably benign	Het
Gabra4	T	C	5: 71,633,542		probably null	Het
Gc	A	G	5: 89,441,200		probably null	Het
Heatr1	T	A	13: 12,424,625	D1361E	probably benign	Het
Hid1	A	G	11: 115,360,357	F118L	probably damaging	Het
Igsf8	G	T	1: 172,318,937	G564W	probably damaging	Het
Il12rb2	A	G	6: 67,336,760	V4A	probably benign	Het
Irak3	T	C	10: 120,146,552	E335G	probably damaging	Het
Itgb8	T	G	12: 119,170,820	Q504P	probably benign	Het
Kbtbd12	A	T	6: 88,618,585	Y88N	probably damaging	Het
Klk1b5	T	C	7: 44,220,545	I226T	probably damaging	Het
L3hypdh	A	T	12: 72,084,753	I135N	probably damaging	Het
Lrp2	G	T	2: 69,503,529	T1456K	probably benign	Het
Mrgprd	C	A	7: 145,321,717	Y108*	probably null	Het
Muc6	C	T	7: 141,647,998	G742D	probably damaging	Het
Nalcn	T	A	14: 123,285,254	I1572F	probably damaging	Het
Nceh1	A	G	3: 27,226,082	Y126C	probably damaging	Het
Olfr125	T	C	17: 37,835,604	S202P	possibly damaging	Het
Olfr356	A	G	2: 36,937,977	N286S	probably damaging	Het
Olfr867	A	T	9: 20,055,126	N112K	possibly damaging	Het
Pacs1	G	T	19: 5,272,615		probably benign	Het
Pappa2	A	G	1: 158,957,398	L14P	probably damaging	Het
Pdlim2	C	T	14: 70,171,239	G176D	probably damaging	Het
Ptpra	T	C	2: 130,503,492	F5L	probably benign	Het
Ralgapa1	A	G	12: 55,676,767	L2114P	possibly damaging	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Senp2	T	A	16: 22,026,666	Y217N	probably damaging	Het
Sned1	C	T	1: 93,283,372	R1061C	probably damaging	Het
Spag16	C	T	1: 70,461,118	T535I	probably benign	Het
Supt20	T	A	3: 54,712,162	L355*	probably null	Het
Tmem132b	A	G	5: 125,787,614	H928R	possibly damaging	Het
Tpo	A	T	12: 30,098,246	L552H	probably damaging	Het
Tsfm	A	T	10: 127,028,455	N130K	probably damaging	Het
Usp48	T	A	4: 137,656,107		probably null	Het
Vsig10	A	G	5: 117,352,760	D544G	probably benign	Het
Vsig10l	C	T	7: 43,465,368	T433I	possibly damaging	Het
Wdr81	A	G	11: 75,445,596	F1655L	probably damaging	Het
Wfdc3	T	A	2: 164,734,191	D60V	probably damaging	Het

Other mutations in Atad2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00088:Atad2b	APN	12	5024593	missense	probably damaging	1.00
IGL00917:Atad2b	APN	12	4965837	unclassified	probably benign
IGL01011:Atad2b	APN	12	4965984	missense	probably benign	0.01
IGL01092:Atad2b	APN	12	5017987	missense	probably damaging	0.98
IGL01604:Atad2b	APN	12	4965837	unclassified	probably benign
IGL01924:Atad2b	APN	12	5034093	missense	probably damaging	1.00
IGL02197:Atad2b	APN	12	5018056	missense	possibly damaging	0.84
IGL02397:Atad2b	APN	12	4974046	missense	probably damaging	1.00
IGL02404:Atad2b	APN	12	4941972	missense	probably benign	0.08
IGL02517:Atad2b	APN	12	5018037	missense	probably benign	0.07
IGL02726:Atad2b	APN	12	4974003	nonsense	probably null
IGL02896:Atad2b	APN	12	4958151	missense	probably damaging	1.00
IGL03227:Atad2b	APN	12	5006715	missense	probably damaging	1.00
IGL03265:Atad2b	APN	12	5024628	missense	probably benign	0.24
Plyers	UTSW	12	4973970	missense	probably damaging	1.00
Smidge	UTSW	12	4990949	missense	probably damaging	1.00
Tensor	UTSW	12	4957558	missense	probably damaging	1.00
Traction	UTSW	12	5027182	critical splice donor site	probably null
Vice	UTSW	12	5018002	missense	probably damaging	1.00
K3955:Atad2b	UTSW	12	4954536	splice site	probably benign
P0038:Atad2b	UTSW	12	4954536	splice site	probably benign
PIT4418001:Atad2b	UTSW	12	5024587	missense	probably benign	0.07
PIT4431001:Atad2b	UTSW	12	5031795	missense	possibly damaging	0.77
R0006:Atad2b	UTSW	12	4942030	missense	possibly damaging	0.81
R0006:Atad2b	UTSW	12	4942030	missense	possibly damaging	0.81
R0124:Atad2b	UTSW	12	4952676	missense	probably benign	0.23
R0462:Atad2b	UTSW	12	4941973	missense	possibly damaging	0.79
R0483:Atad2b	UTSW	12	4945035	splice site	probably benign
R0617:Atad2b	UTSW	12	4937401	missense	probably benign	0.43
R0894:Atad2b	UTSW	12	4965915	missense	probably damaging	1.00
R0942:Atad2b	UTSW	12	5024591	missense	probably damaging	1.00
R0960:Atad2b	UTSW	12	5006593	splice site	probably benign
R0973:Atad2b	UTSW	12	5031784	missense	probably benign	0.00
R1306:Atad2b	UTSW	12	4974239	missense	probably benign	0.08
R1530:Atad2b	UTSW	12	4942018	nonsense	probably null
R1678:Atad2b	UTSW	12	4965899	missense	possibly damaging	0.91
R1826:Atad2b	UTSW	12	4974094	missense	probably benign	0.00
R1996:Atad2b	UTSW	12	4990883	missense	probably benign	0.01
R2233:Atad2b	UTSW	12	5006745	missense	probably damaging	1.00
R2235:Atad2b	UTSW	12	5006745	missense	probably damaging	1.00
R2943:Atad2b	UTSW	12	4942067	missense	probably damaging	0.98
R3161:Atad2b	UTSW	12	4939689	missense	possibly damaging	0.87
R3162:Atad2b	UTSW	12	4939689	missense	possibly damaging	0.87
R3162:Atad2b	UTSW	12	4939689	missense	possibly damaging	0.87
R3508:Atad2b	UTSW	12	4950595	critical splice donor site	probably null
R4239:Atad2b	UTSW	12	4985710	missense	probably benign	0.05
R4401:Atad2b	UTSW	12	4940145	missense	probably damaging	0.99
R4558:Atad2b	UTSW	12	4943223	missense	probably benign	0.10
R4559:Atad2b	UTSW	12	4943223	missense	probably benign	0.10
R4573:Atad2b	UTSW	12	4954663	splice site	probably null
R4639:Atad2b	UTSW	12	5018053	missense	probably damaging	1.00
R4847:Atad2b	UTSW	12	4944901	splice site	probably null
R4850:Atad2b	UTSW	12	4943251	missense	probably benign	0.15
R4851:Atad2b	UTSW	12	4943251	missense	probably benign	0.15
R4979:Atad2b	UTSW	12	5034513	missense	probably damaging	1.00
R5024:Atad2b	UTSW	12	4937534	missense	probably benign	0.45
R5305:Atad2b	UTSW	12	4965855	missense	probably damaging	1.00
R5405:Atad2b	UTSW	12	4940098	missense	possibly damaging	0.87
R5627:Atad2b	UTSW	12	4917911	missense	probably benign	0.01
R5754:Atad2b	UTSW	12	5010351	missense	probably benign	0.01
R6163:Atad2b	UTSW	12	4954593	missense	probably benign	0.00
R6371:Atad2b	UTSW	12	4973970	missense	probably damaging	1.00
R6374:Atad2b	UTSW	12	5018002	missense	probably damaging	1.00
R6399:Atad2b	UTSW	12	4957558	missense	probably damaging	1.00
R6433:Atad2b	UTSW	12	4952642	missense	possibly damaging	0.89
R6546:Atad2b	UTSW	12	4990949	missense	probably damaging	1.00
R6617:Atad2b	UTSW	12	5024668	missense	probably benign	0.00
R7199:Atad2b	UTSW	12	5017992	missense	probably damaging	1.00
R7267:Atad2b	UTSW	12	5027105	nonsense	probably null
R7405:Atad2b	UTSW	12	4943232	missense	probably benign	0.08
R7460:Atad2b	UTSW	12	4952660	missense	probably benign	0.28
R7568:Atad2b	UTSW	12	5010390	critical splice donor site	probably null
R7593:Atad2b	UTSW	12	5031726	missense	probably benign	0.16
R7648:Atad2b	UTSW	12	5027182	critical splice donor site	probably null
R8253:Atad2b	UTSW	12	4974159	missense	possibly damaging	0.54
R8253:Atad2b	UTSW	12	4974160	missense	probably benign	0.02
R8708:Atad2b	UTSW	12	4961253	missense	probably damaging	1.00
R8894:Atad2b	UTSW	12	5014001	critical splice donor site	probably null
R8948:Atad2b	UTSW	12	4991012	missense	possibly damaging	0.87
R8976:Atad2b	UTSW	12	4917923	critical splice donor site	probably null
R9052:Atad2b	UTSW	12	4965982	missense	probably damaging	1.00
R9057:Atad2b	UTSW	12	5018102	nonsense	probably null
R9134:Atad2b	UTSW	12	5010351	missense	probably benign	0.01
R9450:Atad2b	UTSW	12	5013859	missense	probably benign	0.06
R9453:Atad2b	UTSW	12	5031578	missense	probably benign	0.13
R9494:Atad2b	UTSW	12	5031852	missense	probably benign	0.26
R9634:Atad2b	UTSW	12	5010332	missense	probably damaging	1.00
R9764:Atad2b	UTSW	12	5032064	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GCCCCTTGACAGTCCGTTTTCAATG -3'
(R):5'- CGAGCCTCAAACTAGGCAAGTGATG -3'

Sequencing Primer
(F):5'- GAATCGTTTCACCATAGCAGTC -3'
(R):5'- agctacagactcaaccccc -3'

Posted On

2014-05-14