Incidental Mutation 'R1689:Ralgapa1'
ID 189590
Institutional Source Beutler Lab
Gene Symbol Ralgapa1
Ensembl Gene ENSMUSG00000021027
Gene Name Ral GTPase activating protein, alpha subunit 1
Synonyms Garnl1, 4930400K19Rik, 2310003F20Rik, Tulip1
MMRRC Submission 039722-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.812) question?
Stock # R1689 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 55602896-55821167 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 55676767 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 2114 (L2114P)
Ref Sequence ENSEMBL: ENSMUSP00000154749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085385] [ENSMUST00000110687] [ENSMUST00000219432] [ENSMUST00000220367] [ENSMUST00000226244]
AlphaFold Q6GYP7
Predicted Effect probably benign
Transcript: ENSMUST00000085385
AA Change: L1658P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000082503
Gene: ENSMUSG00000021027
AA Change: L1658P

DomainStartEndE-ValueType
low complexity region 644 651 N/A INTRINSIC
low complexity region 676 690 N/A INTRINSIC
low complexity region 692 704 N/A INTRINSIC
low complexity region 894 915 N/A INTRINSIC
low complexity region 1386 1395 N/A INTRINSIC
low complexity region 1784 1798 N/A INTRINSIC
Pfam:Rap_GAP 1824 2003 7.4e-66 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110687
AA Change: L1658P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106315
Gene: ENSMUSG00000021027
AA Change: L1658P

DomainStartEndE-ValueType
low complexity region 644 651 N/A INTRINSIC
low complexity region 676 690 N/A INTRINSIC
low complexity region 692 704 N/A INTRINSIC
low complexity region 894 915 N/A INTRINSIC
low complexity region 1386 1395 N/A INTRINSIC
low complexity region 1784 1798 N/A INTRINSIC
Pfam:Rap_GAP 1824 2001 1.9e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000219432
AA Change: L1705P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000219566
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220017
Predicted Effect probably benign
Transcript: ENSMUST00000220367
AA Change: L1658P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect possibly damaging
Transcript: ENSMUST00000226244
AA Change: L2114P

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a major subunit of the RAL-GTPase activating protein. A similar protein in mouse binds E12, a transcriptional regulator of immunoglobulin genes. The mouse protein also functions in skeletal muscle by binding to the regulatory 14-3-3 proteins upon stimulation with insulin or muscle contraction. A pseudogene of this gene has been identified on chromosome 9. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 T C 7: 46,120,403 K896R probably benign Het
Adcy9 A T 16: 4,297,562 probably null Het
Adgre1 T C 17: 57,449,921 F726S probably benign Het
Ahctf1 A T 1: 179,768,383 S148T probably damaging Het
Aif1 G A 17: 35,172,151 P44L probably benign Het
Ammecr1l C A 18: 31,780,688 A289D probably benign Het
Amotl1 T C 9: 14,593,222 Y230C probably damaging Het
Armc6 A T 8: 70,229,537 S65R probably benign Het
Atad2b T A 12: 5,034,575 Y1440* probably null Het
Atf6b T A 17: 34,650,302 D164E probably damaging Het
B020004J07Rik T A 4: 101,837,179 K169I possibly damaging Het
B4galt6 C T 18: 20,706,496 S127N probably benign Het
Bcl11a A T 11: 24,163,167 Y170F probably damaging Het
Bcl11a A T 11: 24,164,406 D583V possibly damaging Het
Btnl1 T A 17: 34,381,208 Y228* probably null Het
C130060K24Rik A G 6: 65,381,607 N105S possibly damaging Het
Cav2 A G 6: 17,281,422 H21R probably benign Het
Celsr2 T A 3: 108,407,304 D1135V possibly damaging Het
Cntnap1 A C 11: 101,188,873 probably null Het
Cysltr2 T C 14: 73,030,030 D80G possibly damaging Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Dgkh A T 14: 78,618,544 M363K possibly damaging Het
Eml5 C T 12: 98,830,935 V1112M probably damaging Het
Entpd7 A G 19: 43,725,476 T425A probably damaging Het
Ephx2 T A 14: 66,087,026 K373* probably null Het
F5 G C 1: 164,198,917 R1686P probably damaging Het
Fbxw10 A T 11: 62,860,036 I482L probably damaging Het
Fbxw8 T C 5: 118,077,617 S443G probably damaging Het
Fdft1 T C 14: 63,156,689 E191G probably benign Het
Fgd2 A G 17: 29,363,722 E26G probably benign Het
Gabra4 T C 5: 71,633,542 probably null Het
Gc A G 5: 89,441,200 probably null Het
Heatr1 T A 13: 12,424,625 D1361E probably benign Het
Hid1 A G 11: 115,360,357 F118L probably damaging Het
Igsf8 G T 1: 172,318,937 G564W probably damaging Het
Il12rb2 A G 6: 67,336,760 V4A probably benign Het
Irak3 T C 10: 120,146,552 E335G probably damaging Het
Itgb8 T G 12: 119,170,820 Q504P probably benign Het
Kbtbd12 A T 6: 88,618,585 Y88N probably damaging Het
Klk1b5 T C 7: 44,220,545 I226T probably damaging Het
L3hypdh A T 12: 72,084,753 I135N probably damaging Het
Lrp2 G T 2: 69,503,529 T1456K probably benign Het
Mrgprd C A 7: 145,321,717 Y108* probably null Het
Muc6 C T 7: 141,647,998 G742D probably damaging Het
Nalcn T A 14: 123,285,254 I1572F probably damaging Het
Nceh1 A G 3: 27,226,082 Y126C probably damaging Het
Olfr125 T C 17: 37,835,604 S202P possibly damaging Het
Olfr356 A G 2: 36,937,977 N286S probably damaging Het
Olfr867 A T 9: 20,055,126 N112K possibly damaging Het
Pacs1 G T 19: 5,272,615 probably benign Het
Pappa2 A G 1: 158,957,398 L14P probably damaging Het
Pdlim2 C T 14: 70,171,239 G176D probably damaging Het
Ptpra T C 2: 130,503,492 F5L probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Senp2 T A 16: 22,026,666 Y217N probably damaging Het
Sned1 C T 1: 93,283,372 R1061C probably damaging Het
Spag16 C T 1: 70,461,118 T535I probably benign Het
Supt20 T A 3: 54,712,162 L355* probably null Het
Tmem132b A G 5: 125,787,614 H928R possibly damaging Het
Tpo A T 12: 30,098,246 L552H probably damaging Het
Tsfm A T 10: 127,028,455 N130K probably damaging Het
Usp48 T A 4: 137,656,107 probably null Het
Vsig10 A G 5: 117,352,760 D544G probably benign Het
Vsig10l C T 7: 43,465,368 T433I possibly damaging Het
Wdr81 A G 11: 75,445,596 F1655L probably damaging Het
Wfdc3 T A 2: 164,734,191 D60V probably damaging Het
Other mutations in Ralgapa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Ralgapa1 APN 12 55722773 missense probably damaging 0.98
IGL00494:Ralgapa1 APN 12 55747185 missense probably damaging 1.00
IGL00731:Ralgapa1 APN 12 55702452 missense possibly damaging 0.94
IGL00851:Ralgapa1 APN 12 55709575 missense possibly damaging 0.93
IGL01133:Ralgapa1 APN 12 55642348 missense probably damaging 1.00
IGL01133:Ralgapa1 APN 12 55642359 missense probably damaging 0.99
IGL01354:Ralgapa1 APN 12 55777316 missense possibly damaging 0.68
IGL01514:Ralgapa1 APN 12 55719657 missense probably damaging 0.97
IGL02033:Ralgapa1 APN 12 55642477 missense possibly damaging 0.69
IGL02064:Ralgapa1 APN 12 55708077 missense probably damaging 1.00
IGL02556:Ralgapa1 APN 12 55642449 missense possibly damaging 0.80
IGL02605:Ralgapa1 APN 12 55712665 missense possibly damaging 0.90
IGL02657:Ralgapa1 APN 12 55673507 missense probably damaging 1.00
IGL02676:Ralgapa1 APN 12 55676417 missense probably damaging 1.00
IGL02894:Ralgapa1 APN 12 55717069 missense possibly damaging 0.79
IGL02944:Ralgapa1 APN 12 55757951 missense probably benign 0.01
Anhydrous UTSW 12 55795778 critical splice acceptor site probably null
Aqueous UTSW 12 55698854 missense probably damaging 1.00
bantam UTSW 12 55722773 critical splice donor site probably null
Deliquescent UTSW 12 55782900 splice site probably benign
wickedwarlock UTSW 12 55777292 missense probably null 0.99
F5770:Ralgapa1 UTSW 12 55795653 splice site probably benign
IGL03046:Ralgapa1 UTSW 12 55695157 missense probably damaging 1.00
R0011:Ralgapa1 UTSW 12 55786263 missense probably damaging 0.99
R0096:Ralgapa1 UTSW 12 55739505 missense probably damaging 1.00
R0277:Ralgapa1 UTSW 12 55677238 missense probably damaging 0.99
R0323:Ralgapa1 UTSW 12 55677238 missense probably damaging 0.99
R0333:Ralgapa1 UTSW 12 55782900 splice site probably benign
R0361:Ralgapa1 UTSW 12 55676569 missense possibly damaging 0.93
R0385:Ralgapa1 UTSW 12 55677038 missense probably damaging 1.00
R0386:Ralgapa1 UTSW 12 55708067 missense probably benign 0.03
R0498:Ralgapa1 UTSW 12 55689791 missense possibly damaging 0.66
R0552:Ralgapa1 UTSW 12 55676765 missense probably benign 0.27
R0564:Ralgapa1 UTSW 12 55782885 missense possibly damaging 0.84
R0611:Ralgapa1 UTSW 12 55795698 missense probably damaging 0.99
R0730:Ralgapa1 UTSW 12 55665663 missense probably damaging 1.00
R0741:Ralgapa1 UTSW 12 55676581 missense probably damaging 0.99
R0815:Ralgapa1 UTSW 12 55762681 nonsense probably null
R0815:Ralgapa1 UTSW 12 55782777 splice site probably benign
R0863:Ralgapa1 UTSW 12 55762681 nonsense probably null
R0863:Ralgapa1 UTSW 12 55782777 splice site probably benign
R1068:Ralgapa1 UTSW 12 55790310 critical splice donor site probably null
R1147:Ralgapa1 UTSW 12 55702480 missense probably damaging 1.00
R1147:Ralgapa1 UTSW 12 55702480 missense probably damaging 1.00
R1256:Ralgapa1 UTSW 12 55762661 missense possibly damaging 0.94
R1343:Ralgapa1 UTSW 12 55707978 missense probably damaging 1.00
R1378:Ralgapa1 UTSW 12 55676926 missense probably damaging 1.00
R1474:Ralgapa1 UTSW 12 55741480 missense probably benign 0.09
R1494:Ralgapa1 UTSW 12 55684524 missense probably damaging 0.99
R1593:Ralgapa1 UTSW 12 55770703 missense probably damaging 1.00
R1607:Ralgapa1 UTSW 12 55741536 missense probably damaging 1.00
R1681:Ralgapa1 UTSW 12 55762603 missense probably benign 0.35
R1714:Ralgapa1 UTSW 12 55642389 missense probably damaging 1.00
R1832:Ralgapa1 UTSW 12 55757967 missense probably benign 0.03
R1870:Ralgapa1 UTSW 12 55677032 missense possibly damaging 0.66
R2040:Ralgapa1 UTSW 12 55786322 missense probably damaging 1.00
R2043:Ralgapa1 UTSW 12 55677026 missense probably damaging 0.99
R2046:Ralgapa1 UTSW 12 55695160 missense probably damaging 1.00
R2109:Ralgapa1 UTSW 12 55776188 missense possibly damaging 0.90
R2114:Ralgapa1 UTSW 12 55786349 critical splice acceptor site probably null
R2115:Ralgapa1 UTSW 12 55786349 critical splice acceptor site probably null
R2202:Ralgapa1 UTSW 12 55612800 splice site probably null
R2203:Ralgapa1 UTSW 12 55612800 splice site probably null
R2233:Ralgapa1 UTSW 12 55717071 missense probably benign 0.13
R2235:Ralgapa1 UTSW 12 55717071 missense probably benign 0.13
R2341:Ralgapa1 UTSW 12 55677124 missense possibly damaging 0.66
R2507:Ralgapa1 UTSW 12 55718201 missense probably damaging 1.00
R2508:Ralgapa1 UTSW 12 55718201 missense probably damaging 1.00
R2972:Ralgapa1 UTSW 12 55820755 missense possibly damaging 0.61
R3160:Ralgapa1 UTSW 12 55709586 missense probably damaging 1.00
R3162:Ralgapa1 UTSW 12 55709586 missense probably damaging 1.00
R3401:Ralgapa1 UTSW 12 55659137 missense possibly damaging 0.66
R3416:Ralgapa1 UTSW 12 55770613 splice site probably benign
R3499:Ralgapa1 UTSW 12 55695143 splice site probably benign
R3799:Ralgapa1 UTSW 12 55659130 missense probably damaging 1.00
R3948:Ralgapa1 UTSW 12 55698767 missense probably damaging 1.00
R4039:Ralgapa1 UTSW 12 55795701 missense probably damaging 0.99
R4120:Ralgapa1 UTSW 12 55640644 missense probably damaging 1.00
R4165:Ralgapa1 UTSW 12 55640644 missense probably damaging 1.00
R4166:Ralgapa1 UTSW 12 55640644 missense probably damaging 1.00
R4212:Ralgapa1 UTSW 12 55739330 critical splice donor site probably null
R4232:Ralgapa1 UTSW 12 55640644 missense probably damaging 1.00
R4233:Ralgapa1 UTSW 12 55640644 missense probably damaging 1.00
R4234:Ralgapa1 UTSW 12 55640644 missense probably damaging 1.00
R4235:Ralgapa1 UTSW 12 55640644 missense probably damaging 1.00
R4399:Ralgapa1 UTSW 12 55795778 critical splice acceptor site probably null
R4698:Ralgapa1 UTSW 12 55677276 splice site probably null
R4715:Ralgapa1 UTSW 12 55693458 missense probably damaging 1.00
R4755:Ralgapa1 UTSW 12 55712748 missense probably damaging 1.00
R4810:Ralgapa1 UTSW 12 55794993 critical splice donor site probably null
R4827:Ralgapa1 UTSW 12 55676437 missense probably damaging 1.00
R4849:Ralgapa1 UTSW 12 55698803 missense probably damaging 0.99
R4934:Ralgapa1 UTSW 12 55762574 missense possibly damaging 0.94
R5006:Ralgapa1 UTSW 12 55718114 missense probably benign 0.02
R5114:Ralgapa1 UTSW 12 55612723 missense possibly damaging 0.84
R5140:Ralgapa1 UTSW 12 55776152 missense probably damaging 1.00
R5140:Ralgapa1 UTSW 12 55665674 missense probably damaging 1.00
R5168:Ralgapa1 UTSW 12 55758032 missense probably benign 0.05
R5407:Ralgapa1 UTSW 12 55676797 missense possibly damaging 0.93
R5441:Ralgapa1 UTSW 12 55719623 missense probably damaging 1.00
R5473:Ralgapa1 UTSW 12 55676710 missense probably benign 0.41
R5624:Ralgapa1 UTSW 12 55612738 missense probably damaging 1.00
R5766:Ralgapa1 UTSW 12 55820766 start codon destroyed probably null 0.99
R5826:Ralgapa1 UTSW 12 55677113 missense probably damaging 1.00
R5950:Ralgapa1 UTSW 12 55738265 missense possibly damaging 0.58
R5980:Ralgapa1 UTSW 12 55770616 splice site probably null
R6019:Ralgapa1 UTSW 12 55684042 missense possibly damaging 0.92
R6065:Ralgapa1 UTSW 12 55757924 critical splice donor site probably null
R6326:Ralgapa1 UTSW 12 55747146 missense probably damaging 1.00
R6355:Ralgapa1 UTSW 12 55698854 missense probably damaging 1.00
R6408:Ralgapa1 UTSW 12 55683910 nonsense probably null
R6448:Ralgapa1 UTSW 12 55719661 missense probably benign 0.14
R6453:Ralgapa1 UTSW 12 55738319 missense probably damaging 1.00
R6590:Ralgapa1 UTSW 12 55722773 critical splice donor site probably null
R6690:Ralgapa1 UTSW 12 55722773 critical splice donor site probably null
R6738:Ralgapa1 UTSW 12 55762727 missense probably damaging 1.00
R6836:Ralgapa1 UTSW 12 55604273 splice site probably null
R6936:Ralgapa1 UTSW 12 55786212 missense probably damaging 0.99
R6945:Ralgapa1 UTSW 12 55776191 missense possibly damaging 0.64
R7028:Ralgapa1 UTSW 12 55758059 missense probably damaging 1.00
R7075:Ralgapa1 UTSW 12 55820723 missense possibly damaging 0.66
R7076:Ralgapa1 UTSW 12 55721576 missense possibly damaging 0.82
R7098:Ralgapa1 UTSW 12 55790310 critical splice donor site probably null
R7231:Ralgapa1 UTSW 12 55604191 missense probably damaging 1.00
R7254:Ralgapa1 UTSW 12 55695193 missense probably damaging 1.00
R7326:Ralgapa1 UTSW 12 55709004 missense probably damaging 1.00
R7485:Ralgapa1 UTSW 12 55712672 missense probably damaging 1.00
R7580:Ralgapa1 UTSW 12 55718228 missense probably benign 0.00
R7677:Ralgapa1 UTSW 12 55659143 missense probably damaging 0.96
R7702:Ralgapa1 UTSW 12 55709555 missense probably damaging 1.00
R7702:Ralgapa1 UTSW 12 55709556 missense probably damaging 1.00
R7707:Ralgapa1 UTSW 12 55777292 missense probably null 0.99
R7723:Ralgapa1 UTSW 12 55741513 missense probably benign
R7763:Ralgapa1 UTSW 12 55757955 missense probably benign 0.28
R7791:Ralgapa1 UTSW 12 55741519 missense probably damaging 0.97
R7812:Ralgapa1 UTSW 12 55719628 missense possibly damaging 0.67
R7868:Ralgapa1 UTSW 12 55612638 missense probably benign 0.00
R7895:Ralgapa1 UTSW 12 55747149 missense probably benign 0.44
R7896:Ralgapa1 UTSW 12 55697878 missense probably benign 0.01
R8004:Ralgapa1 UTSW 12 55702457 missense probably damaging 0.99
R8094:Ralgapa1 UTSW 12 55782846 missense probably damaging 0.99
R8213:Ralgapa1 UTSW 12 55722914 missense probably damaging 0.99
R8307:Ralgapa1 UTSW 12 55741523 missense probably damaging 0.99
R8423:Ralgapa1 UTSW 12 55659062 missense probably damaging 0.99
R8462:Ralgapa1 UTSW 12 55676518 missense possibly damaging 0.90
R8469:Ralgapa1 UTSW 12 55739413 missense probably damaging 1.00
R8675:Ralgapa1 UTSW 12 55738217 missense possibly damaging 0.93
R8802:Ralgapa1 UTSW 12 55738316 missense probably damaging 0.99
R8937:Ralgapa1 UTSW 12 55702560 missense probably damaging 0.96
R8953:Ralgapa1 UTSW 12 55820761 missense probably damaging 0.99
R8974:Ralgapa1 UTSW 12 55677006 missense probably benign
R9011:Ralgapa1 UTSW 12 55605529 intron probably benign
R9089:Ralgapa1 UTSW 12 55676566 missense probably damaging 0.97
R9124:Ralgapa1 UTSW 12 55735096 missense probably damaging 1.00
R9254:Ralgapa1 UTSW 12 55722798 missense probably damaging 1.00
R9320:Ralgapa1 UTSW 12 55709058 missense possibly damaging 0.59
R9379:Ralgapa1 UTSW 12 55722798 missense probably damaging 1.00
R9446:Ralgapa1 UTSW 12 55708023 missense probably damaging 0.97
R9684:Ralgapa1 UTSW 12 55612700 missense possibly damaging 0.63
Z1176:Ralgapa1 UTSW 12 55709080 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAAGCTGACTGAGGTTTCTGAGGTG -3'
(R):5'- GTGGTGGTCCTGCTATGCTAACAAG -3'

Sequencing Primer
(F):5'- CCGTGTATTGCTTAAGGATAGC -3'
(R):5'- CTGCTATGCTAACAAGTCAGGTG -3'
Posted On 2014-05-14