Mutagenetix > Incidental Mutation

Incidental Mutation 'R1689:Eml5'

189592

Institutional Source

Beutler Lab

Gene Symbol

Eml5

Ensembl Gene

ENSMUSG00000051166

Gene Name

echinoderm microtubule associated protein like 5

Synonyms

C130068M19Rik

MMRRC Submission

039722-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.225) question?

Stock #

R1689 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

98786805-98901484 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 98830935 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 1112 (V1112M)

Ref Sequence

ENSEMBL: ENSMUSP00000152709 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065716] [ENSMUST00000223282]

AlphaFold

Q8BQM8

Predicted Effect

probably damaging
Transcript: ENSMUST00000065716
AA Change: V1073M

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000065643
Gene: ENSMUSG00000051166
AA Change: V1073M

Domain	Start	End	E-Value	Type
Pfam:HELP	1	49	3.3e-21	PFAM
WD40	50	91	6.42e-1	SMART
WD40	94	136	1.08e-4	SMART
WD40	139	178	1.27e-1	SMART
WD40	184	224	2.75e1	SMART
WD40	225	263	2.65e-4	SMART
Blast:WD40	265	312	2e-22	BLAST
WD40	313	353	4.69e-5	SMART
WD40	356	394	2.2e2	SMART
WD40	397	436	8.59e-1	SMART
WD40	444	479	6.6e1	SMART
WD40	505	546	2.74e2	SMART
WD40	552	592	4.8e-2	SMART
low complexity region	609	632	N/A	INTRINSIC
Pfam:HELP	656	715	1.4e-20	PFAM
WD40	716	757	1.18e-1	SMART
WD40	760	802	2.84e-4	SMART
WD40	805	844	1.91e1	SMART
WD40	853	891	2.64e2	SMART
WD40	892	929	3.45e-3	SMART
WD40	985	1026	4.55e-3	SMART
WD40	1029	1068	6.39e0	SMART
WD40	1071	1111	5.15e-2	SMART
WD40	1180	1221	1.9e2	SMART
WD40	1227	1267	1.38e0	SMART
low complexity region	1280	1297	N/A	INTRINSIC
Pfam:HELP	1335	1410	2.4e-16	PFAM
Blast:WD40	1412	1462	8e-28	BLAST
WD40	1465	1507	1.56e-1	SMART
WD40	1510	1549	2.06e0	SMART
WD40	1558	1597	8.22e1	SMART
WD40	1599	1644	4.26e1	SMART
WD40	1690	1730	2.19e-5	SMART
WD40	1774	1813	5.97e-1	SMART
WD40	1884	1925	2.39e0	SMART
WD40	1931	1971	2.88e-1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221662

Predicted Effect

probably benign
Transcript: ENSMUST00000222128

Predicted Effect

probably damaging
Transcript: ENSMUST00000223282
AA Change: V1112M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 93.9%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc8	T	C	7: 46,120,403	K896R	probably benign	Het
Adcy9	A	T	16: 4,297,562		probably null	Het
Adgre1	T	C	17: 57,449,921	F726S	probably benign	Het
Ahctf1	A	T	1: 179,768,383	S148T	probably damaging	Het
Aif1	G	A	17: 35,172,151	P44L	probably benign	Het
Ammecr1l	C	A	18: 31,780,688	A289D	probably benign	Het
Amotl1	T	C	9: 14,593,222	Y230C	probably damaging	Het
Armc6	A	T	8: 70,229,537	S65R	probably benign	Het
Atad2b	T	A	12: 5,034,575	Y1440*	probably null	Het
Atf6b	T	A	17: 34,650,302	D164E	probably damaging	Het
B020004J07Rik	T	A	4: 101,837,179	K169I	possibly damaging	Het
B4galt6	C	T	18: 20,706,496	S127N	probably benign	Het
Bcl11a	A	T	11: 24,164,406	D583V	possibly damaging	Het
Bcl11a	A	T	11: 24,163,167	Y170F	probably damaging	Het
Btnl1	T	A	17: 34,381,208	Y228*	probably null	Het
C130060K24Rik	A	G	6: 65,381,607	N105S	possibly damaging	Het
Cav2	A	G	6: 17,281,422	H21R	probably benign	Het
Celsr2	T	A	3: 108,407,304	D1135V	possibly damaging	Het
Cntnap1	A	C	11: 101,188,873		probably null	Het
Cysltr2	T	C	14: 73,030,030	D80G	possibly damaging	Het
Dclk2	C	T	3: 86,805,639	R503Q	possibly damaging	Het
Dgkh	A	T	14: 78,618,544	M363K	possibly damaging	Het
Entpd7	A	G	19: 43,725,476	T425A	probably damaging	Het
Ephx2	T	A	14: 66,087,026	K373*	probably null	Het
F5	G	C	1: 164,198,917	R1686P	probably damaging	Het
Fbxw10	A	T	11: 62,860,036	I482L	probably damaging	Het
Fbxw8	T	C	5: 118,077,617	S443G	probably damaging	Het
Fdft1	T	C	14: 63,156,689	E191G	probably benign	Het
Fgd2	A	G	17: 29,363,722	E26G	probably benign	Het
Gabra4	T	C	5: 71,633,542		probably null	Het
Gc	A	G	5: 89,441,200		probably null	Het
Heatr1	T	A	13: 12,424,625	D1361E	probably benign	Het
Hid1	A	G	11: 115,360,357	F118L	probably damaging	Het
Igsf8	G	T	1: 172,318,937	G564W	probably damaging	Het
Il12rb2	A	G	6: 67,336,760	V4A	probably benign	Het
Irak3	T	C	10: 120,146,552	E335G	probably damaging	Het
Itgb8	T	G	12: 119,170,820	Q504P	probably benign	Het
Kbtbd12	A	T	6: 88,618,585	Y88N	probably damaging	Het
Klk1b5	T	C	7: 44,220,545	I226T	probably damaging	Het
L3hypdh	A	T	12: 72,084,753	I135N	probably damaging	Het
Lrp2	G	T	2: 69,503,529	T1456K	probably benign	Het
Mrgprd	C	A	7: 145,321,717	Y108*	probably null	Het
Muc6	C	T	7: 141,647,998	G742D	probably damaging	Het
Nalcn	T	A	14: 123,285,254	I1572F	probably damaging	Het
Nceh1	A	G	3: 27,226,082	Y126C	probably damaging	Het
Olfr125	T	C	17: 37,835,604	S202P	possibly damaging	Het
Olfr356	A	G	2: 36,937,977	N286S	probably damaging	Het
Olfr867	A	T	9: 20,055,126	N112K	possibly damaging	Het
Pacs1	G	T	19: 5,272,615		probably benign	Het
Pappa2	A	G	1: 158,957,398	L14P	probably damaging	Het
Pdlim2	C	T	14: 70,171,239	G176D	probably damaging	Het
Ptpra	T	C	2: 130,503,492	F5L	probably benign	Het
Ralgapa1	A	G	12: 55,676,767	L2114P	possibly damaging	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Senp2	T	A	16: 22,026,666	Y217N	probably damaging	Het
Sned1	C	T	1: 93,283,372	R1061C	probably damaging	Het
Spag16	C	T	1: 70,461,118	T535I	probably benign	Het
Supt20	T	A	3: 54,712,162	L355*	probably null	Het
Tmem132b	A	G	5: 125,787,614	H928R	possibly damaging	Het
Tpo	A	T	12: 30,098,246	L552H	probably damaging	Het
Tsfm	A	T	10: 127,028,455	N130K	probably damaging	Het
Usp48	T	A	4: 137,656,107		probably null	Het
Vsig10	A	G	5: 117,352,760	D544G	probably benign	Het
Vsig10l	C	T	7: 43,465,368	T433I	possibly damaging	Het
Wdr81	A	G	11: 75,445,596	F1655L	probably damaging	Het
Wfdc3	T	A	2: 164,734,191	D60V	probably damaging	Het

Other mutations in Eml5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00091:Eml5	APN	12	98873209	splice site	probably benign
IGL00473:Eml5	APN	12	98805492	splice site	probably benign
IGL01120:Eml5	APN	12	98844019	missense	probably benign
IGL01308:Eml5	APN	12	98802313	missense	probably damaging	1.00
IGL01790:Eml5	APN	12	98798932	missense	probably damaging	1.00
IGL01973:Eml5	APN	12	98863280	missense	probably benign
IGL02182:Eml5	APN	12	98802322	missense	probably damaging	1.00
IGL02201:Eml5	APN	12	98794424	splice site	probably benign
IGL02375:Eml5	APN	12	98844087	missense	probably damaging	1.00
IGL02397:Eml5	APN	12	98790674	missense	probably benign	0.07
IGL02480:Eml5	APN	12	98876243	missense	probably damaging	1.00
IGL02801:Eml5	APN	12	98817845	missense	possibly damaging	0.88
IGL02876:Eml5	APN	12	98858841	missense	probably damaging	1.00
IGL03104:Eml5	APN	12	98861245	nonsense	probably null
IGL03158:Eml5	APN	12	98827514	splice site	probably benign
IGL03286:Eml5	APN	12	98860503	missense	probably damaging	1.00
IGL03380:Eml5	APN	12	98874647	splice site	probably benign
BB010:Eml5	UTSW	12	98844020	missense	possibly damaging	0.87
BB020:Eml5	UTSW	12	98844020	missense	possibly damaging	0.87
R0573:Eml5	UTSW	12	98824772	splice site	probably null
R0624:Eml5	UTSW	12	98865479	missense	probably damaging	1.00
R0993:Eml5	UTSW	12	98861183	missense	probably benign	0.25
R1073:Eml5	UTSW	12	98830973	missense	probably damaging	1.00
R1183:Eml5	UTSW	12	98792046	missense	probably benign	0.31
R1352:Eml5	UTSW	12	98831003	splice site	probably benign
R1469:Eml5	UTSW	12	98858823	missense	probably benign
R1469:Eml5	UTSW	12	98858823	missense	probably benign
R1503:Eml5	UTSW	12	98831174	missense	probably damaging	0.99
R1538:Eml5	UTSW	12	98794276	missense	probably damaging	0.99
R1773:Eml5	UTSW	12	98798839	missense	probably damaging	1.00
R1775:Eml5	UTSW	12	98852704	splice site	probably null
R1791:Eml5	UTSW	12	98887056	missense	probably benign	0.31
R1856:Eml5	UTSW	12	98810584	missense	probably damaging	1.00
R1919:Eml5	UTSW	12	98798839	missense	probably damaging	1.00
R1957:Eml5	UTSW	12	98859961	missense	probably damaging	1.00
R1962:Eml5	UTSW	12	98876311	missense	probably damaging	0.99
R2033:Eml5	UTSW	12	98791386	missense	possibly damaging	0.71
R2035:Eml5	UTSW	12	98794266	missense	probably benign	0.33
R2073:Eml5	UTSW	12	98802446	missense	probably damaging	0.99
R2143:Eml5	UTSW	12	98810605	missense	probably damaging	1.00
R2144:Eml5	UTSW	12	98810605	missense	probably damaging	1.00
R2158:Eml5	UTSW	12	98843946	splice site	probably benign
R2164:Eml5	UTSW	12	98887097	missense	probably damaging	0.99
R2175:Eml5	UTSW	12	98876223	nonsense	probably null
R2200:Eml5	UTSW	12	98825417	missense	probably damaging	1.00
R2234:Eml5	UTSW	12	98841581	missense	probably damaging	1.00
R2504:Eml5	UTSW	12	98844105	missense	possibly damaging	0.71
R2871:Eml5	UTSW	12	98865401	missense	probably damaging	1.00
R2871:Eml5	UTSW	12	98865401	missense	probably damaging	1.00
R2958:Eml5	UTSW	12	98876178	missense	possibly damaging	0.74
R3013:Eml5	UTSW	12	98880808	splice site	probably null
R3118:Eml5	UTSW	12	98865494	missense	probably damaging	0.97
R3735:Eml5	UTSW	12	98855989	missense	possibly damaging	0.78
R3856:Eml5	UTSW	12	98816024	missense	probably damaging	1.00
R3900:Eml5	UTSW	12	98825523	missense	probably damaging	1.00
R3973:Eml5	UTSW	12	98802465	splice site	probably benign
R3976:Eml5	UTSW	12	98802465	splice site	probably benign
R4105:Eml5	UTSW	12	98841548	splice site	probably null
R4107:Eml5	UTSW	12	98841548	splice site	probably null
R4108:Eml5	UTSW	12	98841548	splice site	probably null
R4109:Eml5	UTSW	12	98841548	splice site	probably null
R4258:Eml5	UTSW	12	98865434	missense	probably benign	0.01
R4381:Eml5	UTSW	12	98815955	missense	possibly damaging	0.93
R4590:Eml5	UTSW	12	98837341	missense	possibly damaging	0.91
R4737:Eml5	UTSW	12	98798852	missense	probably damaging	1.00
R4775:Eml5	UTSW	12	98802307	missense	probably benign	0.05
R4850:Eml5	UTSW	12	98790619	missense	probably damaging	1.00
R5007:Eml5	UTSW	12	98830965	missense	probably damaging	1.00
R5092:Eml5	UTSW	12	98792616	missense	probably damaging	1.00
R5123:Eml5	UTSW	12	98874512	missense	probably damaging	1.00
R5124:Eml5	UTSW	12	98792042	missense	probably damaging	1.00
R5273:Eml5	UTSW	12	98790688	missense	probably damaging	1.00
R5369:Eml5	UTSW	12	98858783	missense	probably damaging	1.00
R5430:Eml5	UTSW	12	98794158	missense	probably damaging	1.00
R5748:Eml5	UTSW	12	98825555	missense	probably damaging	0.99
R5769:Eml5	UTSW	12	98790619	missense	probably damaging	1.00
R5832:Eml5	UTSW	12	98876188	missense	probably benign
R6113:Eml5	UTSW	12	98824674	nonsense	probably null
R6131:Eml5	UTSW	12	98861251	missense	probably damaging	0.99
R6175:Eml5	UTSW	12	98794456	missense	possibly damaging	0.69
R6184:Eml5	UTSW	12	98863129	missense	possibly damaging	0.53
R6357:Eml5	UTSW	12	98870884	missense	probably damaging	0.98
R6375:Eml5	UTSW	12	98798868
R6528:Eml5	UTSW	12	98824637	missense	probably benign	0.18
R6657:Eml5	UTSW	12	98791405	missense	probably damaging	0.98
R6717:Eml5	UTSW	12	98827506	missense	probably damaging	1.00
R6751:Eml5	UTSW	12	98865400	missense	probably damaging	1.00
R6833:Eml5	UTSW	12	98887024	missense	probably damaging	1.00
R6834:Eml5	UTSW	12	98887024	missense	probably damaging	1.00
R6972:Eml5	UTSW	12	98876180	missense	probably benign	0.00
R7091:Eml5	UTSW	12	98802474	missense	probably benign	0.16
R7353:Eml5	UTSW	12	98825424	missense
R7644:Eml5	UTSW	12	98855944	missense	probably benign	0.05
R7694:Eml5	UTSW	12	98792563	missense	probably damaging	0.99
R7842:Eml5	UTSW	12	98794135	missense	probably damaging	1.00
R7933:Eml5	UTSW	12	98844020	missense	possibly damaging	0.87
R8111:Eml5	UTSW	12	98792514	critical splice donor site	probably null
R8198:Eml5	UTSW	12	98858886	nonsense	probably null
R8482:Eml5	UTSW	12	98876301	missense	probably damaging	1.00
R8732:Eml5	UTSW	12	98815959	missense	probably damaging	0.99
R8956:Eml5	UTSW	12	98852693	missense	possibly damaging	0.69
R8975:Eml5	UTSW	12	98810570	missense	probably damaging	0.99
R9131:Eml5	UTSW	12	98858840	missense	probably damaging	1.00
R9258:Eml5	UTSW	12	98844117	missense	possibly damaging	0.77
R9261:Eml5	UTSW	12	98856028	missense	probably damaging	0.99
R9276:Eml5	UTSW	12	98798801	missense	probably damaging	0.99
R9301:Eml5	UTSW	12	98882033	nonsense	probably null
R9368:Eml5	UTSW	12	98796578	missense	probably benign	0.31
R9392:Eml5	UTSW	12	98900940	missense	probably damaging	1.00
R9393:Eml5	UTSW	12	98876174	missense	probably benign	0.35
R9449:Eml5	UTSW	12	98861295	missense	probably damaging	1.00
R9570:Eml5	UTSW	12	98815984	missense	probably benign	0.15
T0722:Eml5	UTSW	12	98841582	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- CGCCACCTATGCTCTGAAAGTCTG -3'
(R):5'- AGCTTTGGCTGTGGGTCTCAAC -3'

Sequencing Primer
(F):5'- TGCTCTGAAAGTCTGAACCTG -3'
(R):5'- GGCCAATGCTGACACTCTG -3'

Posted On

2014-05-14