Mutagenetix > Incidental Mutation

Incidental Mutation 'R1689:Heatr1'

189594

Institutional Source

Beutler Lab

Gene Symbol

Heatr1

Ensembl Gene

ENSMUSG00000050244

Gene Name

HEAT repeat containing 1

Synonyms

B130016L12Rik

MMRRC Submission

039722-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.967) question?

Stock #

R1689 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

12395027-12440289 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 12424625 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 1361 (D1361E)

Ref Sequence

ENSEMBL: ENSMUSP00000054084 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000059270]

AlphaFold

G3X9B1

Predicted Effect

probably benign
Transcript: ENSMUST00000059270
AA Change: D1361E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000054084
Gene: ENSMUSG00000050244
AA Change: D1361E

Domain	Start	End	E-Value	Type
low complexity region	4	15	N/A	INTRINSIC
Pfam:U3snoRNP10	238	354	7e-30	PFAM
SCOP:d1qbkb_	919	1795	3e-8	SMART
low complexity region	1805	1814	N/A	INTRINSIC
BP28CT	1856	2009	2.25e-77	SMART
Blast:BP28CT	2015	2061	2e-15	BLAST
coiled coil region	2109	2137	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221839

Predicted Effect

probably benign
Transcript: ENSMUST00000222091

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 93.9%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc8	T	C	7: 46,120,403	K896R	probably benign	Het
Adcy9	A	T	16: 4,297,562		probably null	Het
Adgre1	T	C	17: 57,449,921	F726S	probably benign	Het
Ahctf1	A	T	1: 179,768,383	S148T	probably damaging	Het
Aif1	G	A	17: 35,172,151	P44L	probably benign	Het
Ammecr1l	C	A	18: 31,780,688	A289D	probably benign	Het
Amotl1	T	C	9: 14,593,222	Y230C	probably damaging	Het
Armc6	A	T	8: 70,229,537	S65R	probably benign	Het
Atad2b	T	A	12: 5,034,575	Y1440*	probably null	Het
Atf6b	T	A	17: 34,650,302	D164E	probably damaging	Het
B020004J07Rik	T	A	4: 101,837,179	K169I	possibly damaging	Het
B4galt6	C	T	18: 20,706,496	S127N	probably benign	Het
Bcl11a	A	T	11: 24,163,167	Y170F	probably damaging	Het
Bcl11a	A	T	11: 24,164,406	D583V	possibly damaging	Het
Btnl1	T	A	17: 34,381,208	Y228*	probably null	Het
C130060K24Rik	A	G	6: 65,381,607	N105S	possibly damaging	Het
Cav2	A	G	6: 17,281,422	H21R	probably benign	Het
Celsr2	T	A	3: 108,407,304	D1135V	possibly damaging	Het
Cntnap1	A	C	11: 101,188,873		probably null	Het
Cysltr2	T	C	14: 73,030,030	D80G	possibly damaging	Het
Dclk2	C	T	3: 86,805,639	R503Q	possibly damaging	Het
Dgkh	A	T	14: 78,618,544	M363K	possibly damaging	Het
Eml5	C	T	12: 98,830,935	V1112M	probably damaging	Het
Entpd7	A	G	19: 43,725,476	T425A	probably damaging	Het
Ephx2	T	A	14: 66,087,026	K373*	probably null	Het
F5	G	C	1: 164,198,917	R1686P	probably damaging	Het
Fbxw10	A	T	11: 62,860,036	I482L	probably damaging	Het
Fbxw8	T	C	5: 118,077,617	S443G	probably damaging	Het
Fdft1	T	C	14: 63,156,689	E191G	probably benign	Het
Fgd2	A	G	17: 29,363,722	E26G	probably benign	Het
Gabra4	T	C	5: 71,633,542		probably null	Het
Gc	A	G	5: 89,441,200		probably null	Het
Hid1	A	G	11: 115,360,357	F118L	probably damaging	Het
Igsf8	G	T	1: 172,318,937	G564W	probably damaging	Het
Il12rb2	A	G	6: 67,336,760	V4A	probably benign	Het
Irak3	T	C	10: 120,146,552	E335G	probably damaging	Het
Itgb8	T	G	12: 119,170,820	Q504P	probably benign	Het
Kbtbd12	A	T	6: 88,618,585	Y88N	probably damaging	Het
Klk1b5	T	C	7: 44,220,545	I226T	probably damaging	Het
L3hypdh	A	T	12: 72,084,753	I135N	probably damaging	Het
Lrp2	G	T	2: 69,503,529	T1456K	probably benign	Het
Mrgprd	C	A	7: 145,321,717	Y108*	probably null	Het
Muc6	C	T	7: 141,647,998	G742D	probably damaging	Het
Nalcn	T	A	14: 123,285,254	I1572F	probably damaging	Het
Nceh1	A	G	3: 27,226,082	Y126C	probably damaging	Het
Olfr125	T	C	17: 37,835,604	S202P	possibly damaging	Het
Olfr356	A	G	2: 36,937,977	N286S	probably damaging	Het
Olfr867	A	T	9: 20,055,126	N112K	possibly damaging	Het
Pacs1	G	T	19: 5,272,615		probably benign	Het
Pappa2	A	G	1: 158,957,398	L14P	probably damaging	Het
Pdlim2	C	T	14: 70,171,239	G176D	probably damaging	Het
Ptpra	T	C	2: 130,503,492	F5L	probably benign	Het
Ralgapa1	A	G	12: 55,676,767	L2114P	possibly damaging	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Senp2	T	A	16: 22,026,666	Y217N	probably damaging	Het
Sned1	C	T	1: 93,283,372	R1061C	probably damaging	Het
Spag16	C	T	1: 70,461,118	T535I	probably benign	Het
Supt20	T	A	3: 54,712,162	L355*	probably null	Het
Tmem132b	A	G	5: 125,787,614	H928R	possibly damaging	Het
Tpo	A	T	12: 30,098,246	L552H	probably damaging	Het
Tsfm	A	T	10: 127,028,455	N130K	probably damaging	Het
Usp48	T	A	4: 137,656,107		probably null	Het
Vsig10	A	G	5: 117,352,760	D544G	probably benign	Het
Vsig10l	C	T	7: 43,465,368	T433I	possibly damaging	Het
Wdr81	A	G	11: 75,445,596	F1655L	probably damaging	Het
Wfdc3	T	A	2: 164,734,191	D60V	probably damaging	Het

Other mutations in Heatr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00666:Heatr1	APN	13	12410450	missense	probably benign	0.00
IGL00863:Heatr1	APN	13	12435128	missense	probably benign	0.02
IGL00899:Heatr1	APN	13	12435176	missense	probably benign	0.31
IGL01147:Heatr1	APN	13	12437912	missense	probably damaging	0.99
IGL01317:Heatr1	APN	13	12399027	missense	probably damaging	1.00
IGL01323:Heatr1	APN	13	12398938	missense	possibly damaging	0.86
IGL01625:Heatr1	APN	13	12413528	missense	probably damaging	0.98
IGL01973:Heatr1	APN	13	12429799	missense	probably benign
IGL02803:Heatr1	APN	13	12433986	missense	probably damaging	0.96
IGL02830:Heatr1	APN	13	12426212	missense	possibly damaging	0.57
IGL02956:Heatr1	APN	13	12416059	missense	possibly damaging	0.53
IGL03000:Heatr1	APN	13	12434411	missense	probably damaging	0.99
IGL03024:Heatr1	APN	13	12407509	unclassified	probably benign
IGL03035:Heatr1	APN	13	12413219	splice site	probably benign
IGL03301:Heatr1	APN	13	12434205	missense	probably damaging	1.00
hasan	UTSW	13	12417447	splice site	probably benign
H8562:Heatr1	UTSW	13	12408713	missense	probably benign	0.13
R0226:Heatr1	UTSW	13	12410562	missense	probably damaging	1.00
R0571:Heatr1	UTSW	13	12430240	missense	probably damaging	0.98
R0722:Heatr1	UTSW	13	12406037	missense	probably benign	0.14
R1264:Heatr1	UTSW	13	12424610	unclassified	probably benign
R1371:Heatr1	UTSW	13	12417632	missense	possibly damaging	0.80
R1388:Heatr1	UTSW	13	12417447	splice site	probably benign
R1396:Heatr1	UTSW	13	12406046	missense	possibly damaging	0.86
R1519:Heatr1	UTSW	13	12412159	missense	probably benign
R1696:Heatr1	UTSW	13	12423721	missense	possibly damaging	0.96
R1756:Heatr1	UTSW	13	12396460	missense	probably benign	0.01
R1859:Heatr1	UTSW	13	12403159	missense	probably damaging	1.00
R1932:Heatr1	UTSW	13	12435185	missense	probably damaging	1.00
R1957:Heatr1	UTSW	13	12396538	missense	probably damaging	1.00
R2018:Heatr1	UTSW	13	12414478	missense	possibly damaging	0.68
R2106:Heatr1	UTSW	13	12412058	missense	probably benign	0.03
R2119:Heatr1	UTSW	13	12432646	missense	probably null	1.00
R2121:Heatr1	UTSW	13	12403264	missense	probably benign	0.10
R2122:Heatr1	UTSW	13	12403264	missense	probably benign	0.10
R2367:Heatr1	UTSW	13	12433724	missense	probably damaging	1.00
R3777:Heatr1	UTSW	13	12413348	missense	possibly damaging	0.92
R3783:Heatr1	UTSW	13	12434460	missense	probably damaging	1.00
R3784:Heatr1	UTSW	13	12434460	missense	probably damaging	1.00
R3786:Heatr1	UTSW	13	12434460	missense	probably damaging	1.00
R3787:Heatr1	UTSW	13	12434460	missense	probably damaging	1.00
R3843:Heatr1	UTSW	13	12435121	missense	probably benign	0.00
R4533:Heatr1	UTSW	13	12434511	missense	probably benign	0.05
R4725:Heatr1	UTSW	13	12424662	nonsense	probably null
R4763:Heatr1	UTSW	13	12430930	missense	possibly damaging	0.65
R4793:Heatr1	UTSW	13	12431837	missense	probably benign	0.00
R4797:Heatr1	UTSW	13	12412048	missense	probably benign	0.36
R4798:Heatr1	UTSW	13	12412048	missense	probably benign	0.36
R4942:Heatr1	UTSW	13	12413510	critical splice acceptor site	probably null
R4952:Heatr1	UTSW	13	12410599	missense	probably benign	0.38
R4954:Heatr1	UTSW	13	12407516	critical splice acceptor site	probably null
R5370:Heatr1	UTSW	13	12401522	missense	probably benign	0.02
R5464:Heatr1	UTSW	13	12433643	missense	probably benign	0.00
R5483:Heatr1	UTSW	13	12398914	missense	probably damaging	1.00
R5497:Heatr1	UTSW	13	12421064	missense	possibly damaging	0.93
R5504:Heatr1	UTSW	13	12406619	missense	possibly damaging	0.64
R5527:Heatr1	UTSW	13	12402760	missense	probably damaging	1.00
R5527:Heatr1	UTSW	13	12404948	missense	probably benign
R5836:Heatr1	UTSW	13	12408736	missense	probably damaging	0.99
R5916:Heatr1	UTSW	13	12434471	missense	probably damaging	1.00
R6018:Heatr1	UTSW	13	12404947	missense	probably benign
R6018:Heatr1	UTSW	13	12406058	missense	probably benign	0.26
R6216:Heatr1	UTSW	13	12432664	missense	probably benign	0.16
R6396:Heatr1	UTSW	13	12406097	missense	possibly damaging	0.86
R6472:Heatr1	UTSW	13	12434230	missense	probably benign	0.29
R6922:Heatr1	UTSW	13	12435075	missense	probably benign	0.00
R7077:Heatr1	UTSW	13	12418164	missense	possibly damaging	0.63
R7297:Heatr1	UTSW	13	12421060	nonsense	probably null
R7445:Heatr1	UTSW	13	12431038	missense	possibly damaging	0.70
R7669:Heatr1	UTSW	13	12411262	missense	probably benign	0.33
R7672:Heatr1	UTSW	13	12438664	missense	probably damaging	0.96
R7772:Heatr1	UTSW	13	12417641	missense	probably benign	0.03
R8205:Heatr1	UTSW	13	12416047	missense	probably benign
R8518:Heatr1	UTSW	13	12410534	missense	probably benign
R8754:Heatr1	UTSW	13	12413294	missense	probably damaging	0.99
R8874:Heatr1	UTSW	13	12430912	missense	probably damaging	1.00
R8992:Heatr1	UTSW	13	12401114	missense	probably damaging	0.98
R9045:Heatr1	UTSW	13	12413352	missense	probably benign	0.00
R9077:Heatr1	UTSW	13	12413366	missense	probably benign
R9183:Heatr1	UTSW	13	12421385	missense	probably damaging	0.99
R9186:Heatr1	UTSW	13	12421346	missense	probably damaging	1.00
R9223:Heatr1	UTSW	13	12404921	missense	probably benign	0.00
R9242:Heatr1	UTSW	13	12433925	missense	probably benign
R9267:Heatr1	UTSW	13	12406608	missense	probably damaging	1.00
R9289:Heatr1	UTSW	13	12432727	missense	probably benign	0.13
R9310:Heatr1	UTSW	13	12438610	missense	probably benign
R9312:Heatr1	UTSW	13	12431684	missense	probably benign
R9358:Heatr1	UTSW	13	12418206	missense	probably benign	0.09
R9385:Heatr1	UTSW	13	12406542	missense	probably damaging	1.00
R9530:Heatr1	UTSW	13	12424726	missense	probably damaging	1.00
R9532:Heatr1	UTSW	13	12414425	missense	possibly damaging	0.72
R9647:Heatr1	UTSW	13	12426798	missense	probably benign	0.00
R9683:Heatr1	UTSW	13	12434259	missense	probably damaging	1.00
R9695:Heatr1	UTSW	13	12423743	missense	probably damaging	1.00
RF011:Heatr1	UTSW	13	12407544	missense	probably benign	0.00
Z1176:Heatr1	UTSW	13	12399008	missense	possibly damaging	0.68

Predicted Primers

PCR Primer
(F):5'- TCAATACATTGGCAGCTATAGGGCG -3'
(R):5'- TGACCTTTTCTCCATAAGCAGCCAC -3'

Sequencing Primer
(F):5'- AGGAAACATCTACATGGTCTAGAAC -3'
(R):5'- AGCCACCAGCACTGTTTTAG -3'

Posted On

2014-05-14