Incidental Mutation 'R1689:Dgkh'
ID189599
Institutional Source Beutler Lab
Gene Symbol Dgkh
Ensembl Gene ENSMUSG00000034731
Gene Namediacylglycerol kinase, eta
Synonyms5930402B05Rik
MMRRC Submission 039722-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1689 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location78558750-78732776 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 78618544 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 363 (M363K)
Ref Sequence ENSEMBL: ENSMUSP00000154036 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074729] [ENSMUST00000226342] [ENSMUST00000227537] [ENSMUST00000227767] [ENSMUST00000228362]
Predicted Effect possibly damaging
Transcript: ENSMUST00000074729
AA Change: M363K

PolyPhen 2 Score 0.860 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000074290
Gene: ENSMUSG00000034731
AA Change: M363K

DomainStartEndE-ValueType
low complexity region 12 32 N/A INTRINSIC
PH 63 157 1.91e-19 SMART
C1 173 222 1.35e-16 SMART
C1 245 295 1.66e-7 SMART
DAGKc 329 454 3.11e-62 SMART
low complexity region 654 667 N/A INTRINSIC
low complexity region 715 730 N/A INTRINSIC
DAGKa 762 919 1.74e-92 SMART
low complexity region 1124 1134 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000226342
AA Change: M363K

PolyPhen 2 Score 0.860 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000227537
AA Change: M248K

PolyPhen 2 Score 0.776 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect probably benign
Transcript: ENSMUST00000227767
AA Change: M230K

PolyPhen 2 Score 0.329 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227820
Predicted Effect possibly damaging
Transcript: ENSMUST00000228362
AA Change: M230K

PolyPhen 2 Score 0.714 (Sensitivity: 0.86; Specificity: 0.92)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the diacylglycerol kinase (DGK) enzyme family. Members of this family are involved in regulating intracellular concentrations of diacylglycerol and phosphatidic acid. Variation in this gene has been associated with bipolar disorder. Alternatively spliced transcript variants have been identified. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 T C 7: 46,120,403 K896R probably benign Het
Adcy9 A T 16: 4,297,562 probably null Het
Adgre1 T C 17: 57,449,921 F726S probably benign Het
Ahctf1 A T 1: 179,768,383 S148T probably damaging Het
Aif1 G A 17: 35,172,151 P44L probably benign Het
Ammecr1l C A 18: 31,780,688 A289D probably benign Het
Amotl1 T C 9: 14,593,222 Y230C probably damaging Het
Armc6 A T 8: 70,229,537 S65R probably benign Het
Atad2b T A 12: 5,034,575 Y1440* probably null Het
Atf6b T A 17: 34,650,302 D164E probably damaging Het
B020004J07Rik T A 4: 101,837,179 K169I possibly damaging Het
B4galt6 C T 18: 20,706,496 S127N probably benign Het
Bcl11a A T 11: 24,163,167 Y170F probably damaging Het
Bcl11a A T 11: 24,164,406 D583V possibly damaging Het
Btnl1 T A 17: 34,381,208 Y228* probably null Het
C130060K24Rik A G 6: 65,381,607 N105S possibly damaging Het
Cav2 A G 6: 17,281,422 H21R probably benign Het
Celsr2 T A 3: 108,407,304 D1135V possibly damaging Het
Cntnap1 A C 11: 101,188,873 probably null Het
Cysltr2 T C 14: 73,030,030 D80G possibly damaging Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Eml5 C T 12: 98,830,935 V1112M probably damaging Het
Entpd7 A G 19: 43,725,476 T425A probably damaging Het
Ephx2 T A 14: 66,087,026 K373* probably null Het
F5 G C 1: 164,198,917 R1686P probably damaging Het
Fbxw10 A T 11: 62,860,036 I482L probably damaging Het
Fbxw8 T C 5: 118,077,617 S443G probably damaging Het
Fdft1 T C 14: 63,156,689 E191G probably benign Het
Fgd2 A G 17: 29,363,722 E26G probably benign Het
Gabra4 T C 5: 71,633,542 probably null Het
Gc A G 5: 89,441,200 probably null Het
Heatr1 T A 13: 12,424,625 D1361E probably benign Het
Hid1 A G 11: 115,360,357 F118L probably damaging Het
Igsf8 G T 1: 172,318,937 G564W probably damaging Het
Il12rb2 A G 6: 67,336,760 V4A probably benign Het
Irak3 T C 10: 120,146,552 E335G probably damaging Het
Itgb8 T G 12: 119,170,820 Q504P probably benign Het
Kbtbd12 A T 6: 88,618,585 Y88N probably damaging Het
Klk1b5 T C 7: 44,220,545 I226T probably damaging Het
L3hypdh A T 12: 72,084,753 I135N probably damaging Het
Lrp2 G T 2: 69,503,529 T1456K probably benign Het
Mrgprd C A 7: 145,321,717 Y108* probably null Het
Muc6 C T 7: 141,647,998 G742D probably damaging Het
Nalcn T A 14: 123,285,254 I1572F probably damaging Het
Nceh1 A G 3: 27,226,082 Y126C probably damaging Het
Olfr125 T C 17: 37,835,604 S202P possibly damaging Het
Olfr356 A G 2: 36,937,977 N286S probably damaging Het
Olfr867 A T 9: 20,055,126 N112K possibly damaging Het
Pacs1 G T 19: 5,272,615 probably benign Het
Pappa2 A G 1: 158,957,398 L14P probably damaging Het
Pdlim2 C T 14: 70,171,239 G176D probably damaging Het
Ptpra T C 2: 130,503,492 F5L probably benign Het
Ralgapa1 A G 12: 55,676,767 L2114P possibly damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Senp2 T A 16: 22,026,666 Y217N probably damaging Het
Sned1 C T 1: 93,283,372 R1061C probably damaging Het
Spag16 C T 1: 70,461,118 T535I probably benign Het
Supt20 T A 3: 54,712,162 L355* probably null Het
Tmem132b A G 5: 125,787,614 H928R possibly damaging Het
Tpo A T 12: 30,098,246 L552H probably damaging Het
Tsfm A T 10: 127,028,455 N130K probably damaging Het
Usp48 T A 4: 137,656,107 probably null Het
Vsig10 A G 5: 117,352,760 D544G probably benign Het
Vsig10l C T 7: 43,465,368 T433I possibly damaging Het
Wdr81 A G 11: 75,445,596 F1655L probably damaging Het
Wfdc3 T A 2: 164,734,191 D60V probably damaging Het
Other mutations in Dgkh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00654:Dgkh APN 14 78609593 missense possibly damaging 0.92
IGL00767:Dgkh APN 14 78587261 splice site probably benign
IGL00787:Dgkh APN 14 78618514 splice site probably benign
IGL01503:Dgkh APN 14 78616270 missense possibly damaging 0.96
IGL02308:Dgkh APN 14 78587576 missense probably benign 0.01
IGL02707:Dgkh APN 14 78585651 missense possibly damaging 0.75
IGL02987:Dgkh APN 14 78589872 critical splice donor site probably null
IGL03058:Dgkh APN 14 78627797 missense probably benign 0.23
IGL03341:Dgkh APN 14 78595491 splice site probably benign
PIT1430001:Dgkh UTSW 14 78581513 missense probably damaging 1.00
PIT4445001:Dgkh UTSW 14 78575942 missense possibly damaging 0.91
R0153:Dgkh UTSW 14 78570129 nonsense probably null
R0730:Dgkh UTSW 14 78584479 missense probably damaging 0.99
R1136:Dgkh UTSW 14 78624889 missense probably damaging 1.00
R1162:Dgkh UTSW 14 78624451 missense probably damaging 1.00
R1771:Dgkh UTSW 14 78609527 missense probably damaging 1.00
R1861:Dgkh UTSW 14 78578792 missense probably benign 0.04
R1916:Dgkh UTSW 14 78595223 missense probably damaging 0.97
R1930:Dgkh UTSW 14 78616505 missense probably damaging 1.00
R1931:Dgkh UTSW 14 78616505 missense probably damaging 1.00
R1956:Dgkh UTSW 14 78618541 missense probably damaging 1.00
R2007:Dgkh UTSW 14 78603049 missense probably benign 0.09
R3747:Dgkh UTSW 14 78584445 missense probably damaging 1.00
R4446:Dgkh UTSW 14 78628083 missense probably damaging 1.00
R4475:Dgkh UTSW 14 78589878 missense possibly damaging 0.80
R4965:Dgkh UTSW 14 78624421 missense probably damaging 1.00
R4970:Dgkh UTSW 14 78618637 missense probably damaging 1.00
R5071:Dgkh UTSW 14 78604532 missense probably damaging 1.00
R5652:Dgkh UTSW 14 78627761 missense probably damaging 1.00
R5726:Dgkh UTSW 14 78624902 missense probably benign 0.16
R5773:Dgkh UTSW 14 78595455 missense probably damaging 1.00
R5855:Dgkh UTSW 14 78624504 critical splice acceptor site probably null
R6041:Dgkh UTSW 14 78587627 missense probably damaging 1.00
R6192:Dgkh UTSW 14 78628064 nonsense probably null
R6868:Dgkh UTSW 14 78624853 missense probably damaging 0.99
R6981:Dgkh UTSW 14 78627742 nonsense probably null
R7095:Dgkh UTSW 14 78627784 missense probably benign 0.07
R7473:Dgkh UTSW 14 78599043 missense probably benign 0.00
R7495:Dgkh UTSW 14 78578799 missense probably benign
R7711:Dgkh UTSW 14 78725019 missense probably benign
R7727:Dgkh UTSW 14 78595145 critical splice donor site probably null
R7823:Dgkh UTSW 14 78604481 missense probably benign
R7846:Dgkh UTSW 14 78618586 missense probably damaging 0.99
R7967:Dgkh UTSW 14 78619816 missense probably benign 0.10
R8085:Dgkh UTSW 14 78587118 critical splice donor site probably null
R8285:Dgkh UTSW 14 78628126 missense probably benign 0.18
X0022:Dgkh UTSW 14 78595461 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGACAAAGCTCAAATGTAGGGACG -3'
(R):5'- ACGGTGATGCGCCAGCATTAAG -3'

Sequencing Primer
(F):5'- agacagggtttctcagtgtg -3'
(R):5'- AAGGAAGGTTCCTTGCTTTCAC -3'
Posted On2014-05-14