Incidental Mutation 'R1689:Nalcn'
ID 189600
Institutional Source Beutler Lab
Gene Symbol Nalcn
Ensembl Gene ENSMUSG00000000197
Gene Name sodium leak channel, non-selective
Synonyms Vgcnl1, A530023G15Rik
MMRRC Submission 039722-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1689 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 123514046-123864556 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 123522666 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 1572 (I1572F)
Ref Sequence ENSEMBL: ENSMUSP00000000201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000201]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000000201
AA Change: I1572F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000000201
Gene: ENSMUSG00000000197
AA Change: I1572F

DomainStartEndE-ValueType
Pfam:Ion_trans 35 333 2.8e-37 PFAM
low complexity region 338 348 N/A INTRINSIC
Pfam:Ion_trans 383 609 5.7e-34 PFAM
coiled coil region 796 830 N/A INTRINSIC
Pfam:Ion_trans 885 1166 2.4e-42 PFAM
Pfam:Ion_trans 1209 1458 6.9e-30 PFAM
low complexity region 1548 1560 N/A INTRINSIC
low complexity region 1634 1649 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NALCN forms a voltage-independent, nonselective, noninactivating cation channel permeable to Na+, K+, and Ca(2+). It is responsible for the neuronal background sodium leak conductance (Lu et al., 2007 [PubMed 17448995]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal breathing at birth and die within 24 hours. Mice homozygous for a gain of function ENU mutation exhibit reduced the total amount and episode duration of REMS. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 T C 7: 45,769,827 (GRCm39) K896R probably benign Het
Adcy9 A T 16: 4,115,426 (GRCm39) probably null Het
Adgre1 T C 17: 57,756,921 (GRCm39) F726S probably benign Het
Ahctf1 A T 1: 179,595,948 (GRCm39) S148T probably damaging Het
Aif1 G A 17: 35,391,127 (GRCm39) P44L probably benign Het
Ammecr1l C A 18: 31,913,741 (GRCm39) A289D probably benign Het
Amotl1 T C 9: 14,504,518 (GRCm39) Y230C probably damaging Het
Armc6 A T 8: 70,682,187 (GRCm39) S65R probably benign Het
Atad2b T A 12: 5,084,575 (GRCm39) Y1440* probably null Het
Atf6b T A 17: 34,869,276 (GRCm39) D164E probably damaging Het
B4galt6 C T 18: 20,839,553 (GRCm39) S127N probably benign Het
Bcl11a A T 11: 24,113,167 (GRCm39) Y170F probably damaging Het
Bcl11a A T 11: 24,114,406 (GRCm39) D583V possibly damaging Het
Btnl1 T A 17: 34,600,182 (GRCm39) Y228* probably null Het
Cav2 A G 6: 17,281,421 (GRCm39) H21R probably benign Het
Celsr2 T A 3: 108,314,620 (GRCm39) D1135V possibly damaging Het
Cntnap1 A C 11: 101,079,699 (GRCm39) probably null Het
Cysltr2 T C 14: 73,267,470 (GRCm39) D80G possibly damaging Het
Dclk2 C T 3: 86,712,946 (GRCm39) R503Q possibly damaging Het
Dgkh A T 14: 78,855,984 (GRCm39) M363K possibly damaging Het
Eml5 C T 12: 98,797,194 (GRCm39) V1112M probably damaging Het
Entpd7 A G 19: 43,713,915 (GRCm39) T425A probably damaging Het
Ephx2 T A 14: 66,324,475 (GRCm39) K373* probably null Het
F5 G C 1: 164,026,486 (GRCm39) R1686P probably damaging Het
Fbxw10 A T 11: 62,750,862 (GRCm39) I482L probably damaging Het
Fbxw8 T C 5: 118,215,682 (GRCm39) S443G probably damaging Het
Fdft1 T C 14: 63,394,138 (GRCm39) E191G probably benign Het
Fgd2 A G 17: 29,582,696 (GRCm39) E26G probably benign Het
Gabra4 T C 5: 71,790,885 (GRCm39) probably null Het
Gc A G 5: 89,589,059 (GRCm39) probably null Het
Heatr1 T A 13: 12,439,506 (GRCm39) D1361E probably benign Het
Hid1 A G 11: 115,251,183 (GRCm39) F118L probably damaging Het
Igsf8 G T 1: 172,146,504 (GRCm39) G564W probably damaging Het
Il12rb2 A G 6: 67,313,744 (GRCm39) V4A probably benign Het
Irak3 T C 10: 119,982,457 (GRCm39) E335G probably damaging Het
Itgb8 T G 12: 119,134,555 (GRCm39) Q504P probably benign Het
Kbtbd12 A T 6: 88,595,567 (GRCm39) Y88N probably damaging Het
Klk1b5 T C 7: 43,869,969 (GRCm39) I226T probably damaging Het
L3hypdh A T 12: 72,131,527 (GRCm39) I135N probably damaging Het
Lrp2 G T 2: 69,333,873 (GRCm39) T1456K probably benign Het
Mrgprd C A 7: 144,875,454 (GRCm39) Y108* probably null Het
Muc6 C T 7: 141,234,265 (GRCm39) G742D probably damaging Het
Nceh1 A G 3: 27,280,231 (GRCm39) Y126C probably damaging Het
Or14j1 T C 17: 38,146,495 (GRCm39) S202P possibly damaging Het
Or1ak2 A G 2: 36,827,989 (GRCm39) N286S probably damaging Het
Or7d11 A T 9: 19,966,422 (GRCm39) N112K possibly damaging Het
Pacs1 G T 19: 5,322,643 (GRCm39) probably benign Het
Pappa2 A G 1: 158,784,968 (GRCm39) L14P probably damaging Het
Pdlim2 C T 14: 70,408,688 (GRCm39) G176D probably damaging Het
Pramel17 T A 4: 101,694,376 (GRCm39) K169I possibly damaging Het
Ptpra T C 2: 130,345,412 (GRCm39) F5L probably benign Het
Qrfprl A G 6: 65,358,591 (GRCm39) N105S possibly damaging Het
Ralgapa1 A G 12: 55,723,552 (GRCm39) L2114P possibly damaging Het
Rif1 GCCACCA GCCA 2: 52,000,336 (GRCm39) probably benign Het
Senp2 T A 16: 21,845,416 (GRCm39) Y217N probably damaging Het
Sned1 C T 1: 93,211,094 (GRCm39) R1061C probably damaging Het
Spag16 C T 1: 70,500,277 (GRCm39) T535I probably benign Het
Supt20 T A 3: 54,619,583 (GRCm39) L355* probably null Het
Tmem132b A G 5: 125,864,678 (GRCm39) H928R possibly damaging Het
Tpo A T 12: 30,148,245 (GRCm39) L552H probably damaging Het
Tsfm A T 10: 126,864,324 (GRCm39) N130K probably damaging Het
Usp48 T A 4: 137,383,418 (GRCm39) probably null Het
Vsig10 A G 5: 117,490,825 (GRCm39) D544G probably benign Het
Vsig10l C T 7: 43,114,792 (GRCm39) T433I possibly damaging Het
Wdr81 A G 11: 75,336,422 (GRCm39) F1655L probably damaging Het
Wfdc3 T A 2: 164,576,111 (GRCm39) D60V probably damaging Het
Other mutations in Nalcn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Nalcn APN 14 123,586,201 (GRCm39) missense probably benign 0.00
IGL00964:Nalcn APN 14 123,532,796 (GRCm39) splice site probably benign
IGL01310:Nalcn APN 14 123,554,661 (GRCm39) missense probably benign 0.00
IGL01578:Nalcn APN 14 123,809,503 (GRCm39) missense probably benign 0.00
IGL01925:Nalcn APN 14 123,529,260 (GRCm39) missense possibly damaging 0.88
IGL02072:Nalcn APN 14 123,560,770 (GRCm39) missense probably benign 0.05
IGL02096:Nalcn APN 14 123,831,915 (GRCm39) missense probably benign 0.11
IGL02212:Nalcn APN 14 123,752,742 (GRCm39) missense probably damaging 0.99
IGL02306:Nalcn APN 14 123,560,750 (GRCm39) missense probably benign 0.07
IGL02471:Nalcn APN 14 123,560,726 (GRCm39) missense probably benign 0.02
IGL02478:Nalcn APN 14 123,558,717 (GRCm39) missense probably benign 0.26
IGL02551:Nalcn APN 14 123,560,750 (GRCm39) missense probably benign 0.07
IGL02630:Nalcn APN 14 123,555,291 (GRCm39) missense probably benign 0.16
IGL02632:Nalcn APN 14 123,555,265 (GRCm39) missense probably benign 0.11
IGL02661:Nalcn APN 14 123,830,321 (GRCm39) splice site probably benign
IGL02830:Nalcn APN 14 123,530,881 (GRCm39) missense probably damaging 0.98
IGL02939:Nalcn APN 14 123,536,284 (GRCm39) missense probably null 1.00
IGL03035:Nalcn APN 14 123,515,630 (GRCm39) nonsense probably null
IGL03226:Nalcn APN 14 123,518,527 (GRCm39) missense probably benign 0.00
IGL03242:Nalcn APN 14 123,558,899 (GRCm39) missense possibly damaging 0.91
Narnia UTSW 14 123,528,459 (GRCm39) missense probably benign 0.11
R0019:Nalcn UTSW 14 123,744,901 (GRCm39) missense probably benign 0.18
R0144:Nalcn UTSW 14 123,647,251 (GRCm39) splice site probably benign
R0144:Nalcn UTSW 14 123,608,948 (GRCm39) missense probably damaging 0.96
R0359:Nalcn UTSW 14 123,536,580 (GRCm39) missense probably damaging 1.00
R0383:Nalcn UTSW 14 123,744,971 (GRCm39) missense probably benign 0.01
R0400:Nalcn UTSW 14 123,528,372 (GRCm39) splice site probably benign
R0467:Nalcn UTSW 14 123,528,459 (GRCm39) missense probably benign 0.11
R0506:Nalcn UTSW 14 123,834,026 (GRCm39) missense possibly damaging 0.82
R0583:Nalcn UTSW 14 123,531,755 (GRCm39) missense possibly damaging 0.46
R0620:Nalcn UTSW 14 123,536,553 (GRCm39) splice site probably benign
R0624:Nalcn UTSW 14 123,607,444 (GRCm39) missense probably benign
R0883:Nalcn UTSW 14 123,702,152 (GRCm39) missense probably damaging 1.00
R1381:Nalcn UTSW 14 123,551,517 (GRCm39) missense probably damaging 1.00
R1467:Nalcn UTSW 14 123,702,068 (GRCm39) splice site probably benign
R1726:Nalcn UTSW 14 123,545,816 (GRCm39) missense probably damaging 1.00
R1774:Nalcn UTSW 14 123,515,678 (GRCm39) missense probably benign
R1854:Nalcn UTSW 14 123,697,824 (GRCm39) missense probably damaging 1.00
R1869:Nalcn UTSW 14 123,831,965 (GRCm39) missense possibly damaging 0.96
R1871:Nalcn UTSW 14 123,831,965 (GRCm39) missense possibly damaging 0.96
R1873:Nalcn UTSW 14 123,521,013 (GRCm39) missense probably benign 0.00
R1899:Nalcn UTSW 14 123,553,538 (GRCm39) missense possibly damaging 0.50
R1915:Nalcn UTSW 14 123,540,181 (GRCm39) missense probably benign 0.08
R2016:Nalcn UTSW 14 123,831,993 (GRCm39) splice site probably null
R2034:Nalcn UTSW 14 123,521,015 (GRCm39) missense probably benign 0.01
R2087:Nalcn UTSW 14 123,518,557 (GRCm39) missense probably benign
R2149:Nalcn UTSW 14 123,607,429 (GRCm39) missense probably benign 0.01
R2157:Nalcn UTSW 14 123,647,164 (GRCm39) missense probably benign 0.32
R2166:Nalcn UTSW 14 123,607,363 (GRCm39) missense probably benign 0.00
R2932:Nalcn UTSW 14 123,830,430 (GRCm39) missense probably benign 0.06
R3408:Nalcn UTSW 14 123,834,029 (GRCm39) missense probably null 0.98
R3778:Nalcn UTSW 14 123,702,128 (GRCm39) missense probably damaging 1.00
R3807:Nalcn UTSW 14 123,515,599 (GRCm39) missense probably damaging 1.00
R3835:Nalcn UTSW 14 123,530,834 (GRCm39) splice site probably benign
R3937:Nalcn UTSW 14 123,607,357 (GRCm39) missense probably benign 0.00
R4001:Nalcn UTSW 14 123,834,006 (GRCm39) missense probably damaging 1.00
R4015:Nalcn UTSW 14 123,723,799 (GRCm39) missense probably damaging 1.00
R4033:Nalcn UTSW 14 123,837,401 (GRCm39) splice site probably benign
R4231:Nalcn UTSW 14 123,837,325 (GRCm39) missense probably benign 0.01
R4464:Nalcn UTSW 14 123,560,762 (GRCm39) missense probably benign
R4512:Nalcn UTSW 14 123,532,860 (GRCm39) missense probably damaging 1.00
R4542:Nalcn UTSW 14 123,558,889 (GRCm39) synonymous silent
R4557:Nalcn UTSW 14 123,558,647 (GRCm39) intron probably benign
R4869:Nalcn UTSW 14 123,837,296 (GRCm39) missense probably benign 0.44
R5083:Nalcn UTSW 14 123,560,706 (GRCm39) splice site probably null
R5109:Nalcn UTSW 14 123,515,650 (GRCm39) missense possibly damaging 0.86
R5131:Nalcn UTSW 14 123,753,182 (GRCm39) missense probably damaging 0.98
R5158:Nalcn UTSW 14 123,753,149 (GRCm39) missense probably damaging 1.00
R5259:Nalcn UTSW 14 123,753,063 (GRCm39) missense possibly damaging 0.94
R5422:Nalcn UTSW 14 123,752,777 (GRCm39) missense probably damaging 1.00
R5514:Nalcn UTSW 14 123,521,123 (GRCm39) missense probably benign 0.14
R5523:Nalcn UTSW 14 123,647,155 (GRCm39) missense probably damaging 1.00
R5551:Nalcn UTSW 14 123,515,698 (GRCm39) missense possibly damaging 0.57
R5667:Nalcn UTSW 14 123,532,818 (GRCm39) missense probably damaging 1.00
R5671:Nalcn UTSW 14 123,532,818 (GRCm39) missense probably damaging 1.00
R5750:Nalcn UTSW 14 123,809,450 (GRCm39) missense probably benign
R5765:Nalcn UTSW 14 123,702,138 (GRCm39) missense possibly damaging 0.46
R6324:Nalcn UTSW 14 123,647,161 (GRCm39) missense possibly damaging 0.83
R6523:Nalcn UTSW 14 123,555,255 (GRCm39) missense probably benign 0.00
R6558:Nalcn UTSW 14 123,723,919 (GRCm39) missense probably benign
R6631:Nalcn UTSW 14 123,697,663 (GRCm39) missense probably benign 0.17
R6667:Nalcn UTSW 14 123,558,735 (GRCm39) missense probably damaging 1.00
R6670:Nalcn UTSW 14 123,702,084 (GRCm39) missense possibly damaging 0.96
R6724:Nalcn UTSW 14 123,535,479 (GRCm39) missense probably damaging 0.99
R6731:Nalcn UTSW 14 123,837,346 (GRCm39) missense probably benign 0.22
R6957:Nalcn UTSW 14 123,744,966 (GRCm39) missense probably damaging 0.96
R6970:Nalcn UTSW 14 123,551,506 (GRCm39) missense possibly damaging 0.46
R7010:Nalcn UTSW 14 123,530,877 (GRCm39) missense probably damaging 1.00
R7018:Nalcn UTSW 14 123,647,233 (GRCm39) missense probably damaging 1.00
R7040:Nalcn UTSW 14 123,525,267 (GRCm39) missense probably benign
R7089:Nalcn UTSW 14 123,515,761 (GRCm39) missense probably benign 0.01
R7128:Nalcn UTSW 14 123,831,914 (GRCm39) missense probably damaging 0.99
R7149:Nalcn UTSW 14 123,837,277 (GRCm39) missense probably benign 0.02
R7361:Nalcn UTSW 14 123,529,251 (GRCm39) missense probably benign 0.00
R7378:Nalcn UTSW 14 123,540,302 (GRCm39) missense probably damaging 1.00
R7408:Nalcn UTSW 14 123,529,272 (GRCm39) missense probably benign 0.00
R7470:Nalcn UTSW 14 123,809,456 (GRCm39) missense probably benign 0.09
R7483:Nalcn UTSW 14 123,551,499 (GRCm39) missense probably damaging 1.00
R7521:Nalcn UTSW 14 123,530,870 (GRCm39) missense probably damaging 1.00
R7558:Nalcn UTSW 14 123,723,797 (GRCm39) critical splice donor site probably null
R7585:Nalcn UTSW 14 123,753,050 (GRCm39) missense probably damaging 1.00
R7591:Nalcn UTSW 14 123,561,297 (GRCm39) missense probably benign 0.01
R7761:Nalcn UTSW 14 123,531,792 (GRCm39) missense probably damaging 1.00
R7761:Nalcn UTSW 14 123,531,791 (GRCm39) missense probably damaging 1.00
R7811:Nalcn UTSW 14 123,536,357 (GRCm39) missense probably damaging 1.00
R7983:Nalcn UTSW 14 123,830,409 (GRCm39) missense probably benign 0.17
R8089:Nalcn UTSW 14 123,537,372 (GRCm39) missense probably damaging 1.00
R8110:Nalcn UTSW 14 123,702,113 (GRCm39) missense probably benign 0.00
R8190:Nalcn UTSW 14 123,837,351 (GRCm39) missense possibly damaging 0.69
R8273:Nalcn UTSW 14 123,554,436 (GRCm39) missense probably damaging 1.00
R8407:Nalcn UTSW 14 123,554,683 (GRCm39) missense probably damaging 1.00
R8497:Nalcn UTSW 14 123,752,771 (GRCm39) missense probably damaging 1.00
R8544:Nalcn UTSW 14 123,608,935 (GRCm39) missense probably benign 0.40
R8549:Nalcn UTSW 14 123,607,448 (GRCm39) missense probably benign 0.01
R8731:Nalcn UTSW 14 123,837,266 (GRCm39) missense probably benign 0.01
R8862:Nalcn UTSW 14 123,647,199 (GRCm39) missense possibly damaging 0.96
R8919:Nalcn UTSW 14 123,561,284 (GRCm39) missense probably benign 0.00
R9072:Nalcn UTSW 14 123,532,863 (GRCm39) missense possibly damaging 0.66
R9073:Nalcn UTSW 14 123,532,863 (GRCm39) missense possibly damaging 0.66
R9182:Nalcn UTSW 14 123,834,016 (GRCm39) missense probably damaging 1.00
R9193:Nalcn UTSW 14 123,545,792 (GRCm39) nonsense probably null
R9241:Nalcn UTSW 14 123,809,429 (GRCm39) missense probably benign 0.00
R9267:Nalcn UTSW 14 123,518,567 (GRCm39) missense probably benign 0.08
R9274:Nalcn UTSW 14 123,753,068 (GRCm39) missense probably damaging 1.00
R9277:Nalcn UTSW 14 123,518,523 (GRCm39) missense probably damaging 0.98
R9376:Nalcn UTSW 14 123,515,713 (GRCm39) missense possibly damaging 0.74
X0060:Nalcn UTSW 14 123,522,653 (GRCm39) missense probably damaging 1.00
Z1177:Nalcn UTSW 14 123,831,980 (GRCm39) missense probably damaging 1.00
Z1177:Nalcn UTSW 14 123,531,857 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGCTGGAACAGTTAAGGCTGCATC -3'
(R):5'- GACCACTTAGCATGGGTCTTCTGC -3'

Sequencing Primer
(F):5'- actcctgccatcttgacatac -3'
(R):5'- gaagagaagatagggagatccag -3'
Posted On 2014-05-14