Mutagenetix > Incidental Mutation

Incidental Mutation 'R1700:Zdbf2'

189617

Institutional Source

Beutler Lab

Gene Symbol

Zdbf2

Ensembl Gene

ENSMUSG00000027520

Gene Name

zinc finger, DBF-type containing 2

Synonyms

4930431J08Rik, 9330107J05Rik

MMRRC Submission

039733-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.111) question?

Stock #

R1700 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

63273265-63314576 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 63302741 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 93 (E93G)

Ref Sequence

ENSEMBL: ENSMUSP00000109767 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029025] [ENSMUST00000114132]

AlphaFold

Q5SS00

Predicted Effect

unknown
Transcript: ENSMUST00000029025
AA Change: E93G

SMART Domains

Protein: ENSMUSP00000029025
Gene: ENSMUSG00000027520
AA Change: E93G

Domain	Start	End	E-Value	Type
low complexity region	79	99	N/A	INTRINSIC
low complexity region	150	164	N/A	INTRINSIC
low complexity region	378	405	N/A	INTRINSIC
internal_repeat_6	407	565	7.68e-5	PROSPERO
internal_repeat_5	418	768	5.53e-5	PROSPERO
internal_repeat_1	618	873	3.17e-15	PROSPERO
internal_repeat_4	621	885	2.09e-6	PROSPERO
internal_repeat_3	642	886	1.52e-7	PROSPERO
internal_repeat_2	650	912	5.87e-11	PROSPERO
internal_repeat_6	722	891	7.68e-5	PROSPERO
low complexity region	965	982	N/A	INTRINSIC
internal_repeat_4	1061	1328	2.09e-6	PROSPERO
internal_repeat_2	1215	1484	5.87e-11	PROSPERO
internal_repeat_3	1287	1507	1.52e-7	PROSPERO
internal_repeat_1	1307	1536	3.17e-15	PROSPERO
internal_repeat_5	1388	1758	5.53e-5	PROSPERO
low complexity region	1767	1778	N/A	INTRINSIC
low complexity region	2211	2235	N/A	INTRINSIC
low complexity region	2240	2399	N/A	INTRINSIC
low complexity region	2402	2420	N/A	INTRINSIC
low complexity region	2446	2458	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000083151

Predicted Effect

unknown
Transcript: ENSMUST00000114132
AA Change: E93G

SMART Domains

Protein: ENSMUSP00000109767
Gene: ENSMUSG00000027520
AA Change: E93G

Domain	Start	End	E-Value	Type
low complexity region	79	99	N/A	INTRINSIC
low complexity region	150	164	N/A	INTRINSIC
low complexity region	378	405	N/A	INTRINSIC
internal_repeat_6	407	565	7.68e-5	PROSPERO
internal_repeat_5	418	768	5.53e-5	PROSPERO
internal_repeat_1	618	873	3.17e-15	PROSPERO
internal_repeat_4	621	885	2.09e-6	PROSPERO
internal_repeat_3	642	886	1.52e-7	PROSPERO
internal_repeat_2	650	912	5.87e-11	PROSPERO
internal_repeat_6	722	891	7.68e-5	PROSPERO
low complexity region	965	982	N/A	INTRINSIC
internal_repeat_4	1061	1328	2.09e-6	PROSPERO
internal_repeat_2	1215	1484	5.87e-11	PROSPERO
internal_repeat_3	1287	1507	1.52e-7	PROSPERO
internal_repeat_1	1307	1536	3.17e-15	PROSPERO
internal_repeat_5	1388	1758	5.53e-5	PROSPERO
low complexity region	1767	1778	N/A	INTRINSIC
low complexity region	2211	2235	N/A	INTRINSIC
low complexity region	2240	2399	N/A	INTRINSIC
low complexity region	2402	2420	N/A	INTRINSIC
low complexity region	2446	2458	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.4%
20x: 92.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing DBF4-type zinc finger domains. This gene is imprinted and paternally expressed in lymphocytes but is more stochastically expressed in the placenta. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2015]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930402H24Rik	G	A	2: 130,709,938	L1010F	probably damaging	Het
Abcb1b	T	C	5: 8,849,537	F936L	probably benign	Het
Adamts12	T	A	15: 11,152,057	I211N	probably benign	Het
Adamts16	G	A	13: 70,779,518		probably benign	Het
Alas1	C	T	9: 106,239,646	V293I	possibly damaging	Het
Ap1g1	T	C	8: 109,853,612	Y569H	probably damaging	Het
Apc2	A	G	10: 80,312,769	D1190G	probably damaging	Het
Astn2	G	A	4: 65,746,354	Q679*	probably null	Het
Atp2a1	T	A	7: 126,462,909	H5L	probably damaging	Het
Baiap3	T	C	17: 25,249,328	K279E	probably damaging	Het
C2cd2l	G	A	9: 44,316,612	P111S	probably benign	Het
C7	T	A	15: 5,002,792	K646*	probably null	Het
Ccp110	C	T	7: 118,735,313	T1003I	probably damaging	Het
Cdh22	T	C	2: 165,170,796	D123G	probably damaging	Het
Cep295	C	T	9: 15,340,883	E397K	probably damaging	Het
Clip1	A	G	5: 123,630,370	V722A	probably benign	Het
Cpsf4l	A	G	11: 113,702,075	F174S	probably benign	Het
Ctnna3	T	C	10: 63,852,772	C332R	probably damaging	Het
Cxcl10	A	T	5: 92,347,855	N76K	probably damaging	Het
Dnaja3	G	A	16: 4,684,165	R11K	probably null	Het
Efcab10	A	G	12: 33,395,171	T28A	possibly damaging	Het
Esrrg	A	G	1: 188,043,653	R103G	probably damaging	Het
Exosc2	A	G	2: 31,670,806	K23E	probably benign	Het
Flot2	C	T	11: 78,049,547	S40L	possibly damaging	Het
Fsip2	T	C	2: 82,991,737	V5938A	probably benign	Het
Gclc	A	G	9: 77,776,289	T143A	probably benign	Het
Gpr37	A	G	6: 25,669,624	V407A	probably benign	Het
Gucy2e	A	T	11: 69,232,058	M497K	probably benign	Het
Herc1	T	A	9: 66,450,678		probably null	Het
Hnrnpll	A	C	17: 80,034,105	S502A	probably benign	Het
Ipo11	G	T	13: 106,795,662	T975N	probably benign	Het
Kif17	C	T	4: 138,262,698	Q66*	probably null	Het
Lrp10	T	C	14: 54,469,752	V682A	possibly damaging	Het
Lsmem1	A	T	12: 40,180,678	L75Q	probably damaging	Het
Med16	A	T	10: 79,899,335	Y430N	probably benign	Het
Med8	C	T	4: 118,412,734	S72L	possibly damaging	Het
Mex3a	A	G	3: 88,536,375	T253A	probably damaging	Het
Myf6	T	C	10: 107,493,359	K242E	probably damaging	Het
Ncald	T	A	15: 37,397,343	Y31F	probably benign	Het
Ndufa12	T	A	10: 94,199,993	Y48N	probably damaging	Het
Olfr1111	T	G	2: 87,149,779	N294T	probably damaging	Het
Olfr1145	T	C	2: 87,810,768	V316A	probably benign	Het
Olfr638	T	A	7: 104,004,122	Y282*	probably null	Het
Pde4dip	T	C	3: 97,703,323	T1858A	probably benign	Het
Pgbd1	A	G	13: 21,434,481	L2P	probably damaging	Het
Piezo1	C	T	8: 122,487,502	R1642H	probably damaging	Het
Plxna1	A	T	6: 89,357,008	M213K	probably damaging	Het
Polr1b	A	G	2: 129,123,121	N709S	probably damaging	Het
Pramel1	T	A	4: 143,398,429	W308R	probably damaging	Het
Prkag2	A	T	5: 24,871,541	I208N	probably damaging	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Rngtt	T	A	4: 33,330,864	F156I	probably damaging	Het
Rpusd3	A	G	6: 113,415,533	*345Q	probably null	Het
Rrp1b	A	G	17: 32,057,204	K575R	probably benign	Het
Shd	G	A	17: 55,974,307	V250I	probably damaging	Het
Slc12a5	C	A	2: 164,992,376	N749K	possibly damaging	Het
Sorbs2	T	A	8: 45,800,984	V488D	probably damaging	Het
Sphkap	G	A	1: 83,277,515	R838*	probably null	Het
Srsf4	C	A	4: 131,900,560		probably benign	Het
Strn	T	C	17: 78,692,402	Y135C	probably damaging	Het
Synm	T	C	7: 67,759,628	M1V	probably null	Het
Tas1r3	T	G	4: 155,861,570	Q489P	probably benign	Het
Tas2r103	A	T	6: 133,036,811	N97K	probably damaging	Het
Tas2r113	A	G	6: 132,893,792	Y261C	possibly damaging	Het
Tex21	T	C	12: 76,221,672	E112G	probably damaging	Het
Trappc8	T	C	18: 20,832,998	S1128G	probably damaging	Het
Ubap1l	A	G	9: 65,371,743		probably benign	Het
Ubash3a	A	G	17: 31,215,044	D121G	probably damaging	Het
Ubxn4	A	G	1: 128,252,286	I56V	possibly damaging	Het
Uri1	T	C	7: 37,963,524	I348M	probably damaging	Het
Usp21	C	A	1: 171,283,722	L379F	probably damaging	Het
Vmn1r159	T	A	7: 22,842,965	H214L	probably damaging	Het

Other mutations in Zdbf2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00790:Zdbf2	APN	1	63306514	missense	possibly damaging	0.92
IGL00796:Zdbf2	APN	1	63307205	missense	probably benign	0.04
IGL00801:Zdbf2	APN	1	63303038	missense	possibly damaging	0.66
IGL02803:Zdbf2	APN	1	63303077	missense	possibly damaging	0.46
R0143:Zdbf2	UTSW	1	63308074	missense	probably benign	0.01
R0147:Zdbf2	UTSW	1	63304006	nonsense	probably null
R0148:Zdbf2	UTSW	1	63304006	nonsense	probably null
R0433:Zdbf2	UTSW	1	63306143	missense	possibly damaging	0.46
R0502:Zdbf2	UTSW	1	63305290	missense	possibly damaging	0.66
R0645:Zdbf2	UTSW	1	63304950	missense	possibly damaging	0.81
R0765:Zdbf2	UTSW	1	63305723	missense	possibly damaging	0.46
R1068:Zdbf2	UTSW	1	63303430	missense	possibly damaging	0.94
R1216:Zdbf2	UTSW	1	63303002	missense	possibly damaging	0.83
R1235:Zdbf2	UTSW	1	63309073	missense	possibly damaging	0.66
R1352:Zdbf2	UTSW	1	63303053	missense	probably damaging	0.96
R1402:Zdbf2	UTSW	1	63303627	missense	possibly damaging	0.46
R1402:Zdbf2	UTSW	1	63303627	missense	possibly damaging	0.46
R1435:Zdbf2	UTSW	1	63303040	missense	possibly damaging	0.66
R1562:Zdbf2	UTSW	1	63303588	missense	possibly damaging	0.83
R1624:Zdbf2	UTSW	1	63303859	missense	possibly damaging	0.66
R1635:Zdbf2	UTSW	1	63304334	missense	possibly damaging	0.92
R1644:Zdbf2	UTSW	1	63308972	missense	possibly damaging	0.66
R1662:Zdbf2	UTSW	1	63304249	nonsense	probably null
R1720:Zdbf2	UTSW	1	63303277	missense	possibly damaging	0.46
R1853:Zdbf2	UTSW	1	63305542	frame shift	probably null
R1854:Zdbf2	UTSW	1	63305542	frame shift	probably null
R1973:Zdbf2	UTSW	1	63309701	missense	unknown
R2336:Zdbf2	UTSW	1	63303464	missense	probably benign	0.00
R2428:Zdbf2	UTSW	1	63305615	missense	probably benign	0.04
R3010:Zdbf2	UTSW	1	63303065	missense	possibly damaging	0.92
R3034:Zdbf2	UTSW	1	63304205	missense	probably damaging	0.96
R3079:Zdbf2	UTSW	1	63307477	missense	probably benign	0.05
R3196:Zdbf2	UTSW	1	63308420	missense	possibly damaging	0.46
R3711:Zdbf2	UTSW	1	63308671	missense	possibly damaging	0.83
R3845:Zdbf2	UTSW	1	63308324	missense	possibly damaging	0.66
R4093:Zdbf2	UTSW	1	63309781	missense	possibly damaging	0.83
R4250:Zdbf2	UTSW	1	63302861	missense	possibly damaging	0.46
R4592:Zdbf2	UTSW	1	63306591	missense	possibly damaging	0.82
R4721:Zdbf2	UTSW	1	63308792	missense	possibly damaging	0.46
R4779:Zdbf2	UTSW	1	63303238	missense	possibly damaging	0.66
R4928:Zdbf2	UTSW	1	63308814	missense	possibly damaging	0.81
R4943:Zdbf2	UTSW	1	63302914	missense	possibly damaging	0.92
R5025:Zdbf2	UTSW	1	63303650	missense	possibly damaging	0.82
R5095:Zdbf2	UTSW	1	63309073	missense	possibly damaging	0.66
R5149:Zdbf2	UTSW	1	63304903	missense	possibly damaging	0.83
R5326:Zdbf2	UTSW	1	63304411	missense	possibly damaging	0.66
R5341:Zdbf2	UTSW	1	63307933	missense	probably benign	0.27
R5511:Zdbf2	UTSW	1	63305677	missense	probably benign	0.03
R5809:Zdbf2	UTSW	1	63305876	missense	possibly damaging	0.90
R5902:Zdbf2	UTSW	1	63306526	missense	possibly damaging	0.83
R6162:Zdbf2	UTSW	1	63280818	start gained	probably benign
R6245:Zdbf2	UTSW	1	63304433	missense	possibly damaging	0.46
R6332:Zdbf2	UTSW	1	63307822	missense	possibly damaging	0.66
R6361:Zdbf2	UTSW	1	63303321	missense	possibly damaging	0.66
R6489:Zdbf2	UTSW	1	63307478	missense	possibly damaging	0.46
R6517:Zdbf2	UTSW	1	63305520	missense	possibly damaging	0.81
R6624:Zdbf2	UTSW	1	63303914	missense	possibly damaging	0.46
R6643:Zdbf2	UTSW	1	63304508	missense	possibly damaging	0.82
R6786:Zdbf2	UTSW	1	63304520	missense	possibly damaging	0.46
R6808:Zdbf2	UTSW	1	63308528	missense	possibly damaging	0.66
R6896:Zdbf2	UTSW	1	63308872	missense	probably damaging	0.98
R6997:Zdbf2	UTSW	1	63290766	missense	probably benign	0.09
R7011:Zdbf2	UTSW	1	63306766	missense	possibly damaging	0.66
R7058:Zdbf2	UTSW	1	63307404	missense	possibly damaging	0.66
R7066:Zdbf2	UTSW	1	63307559	missense	probably benign
R7177:Zdbf2	UTSW	1	63294961	missense	possibly damaging	0.94
R7184:Zdbf2	UTSW	1	63306505	missense	possibly damaging	0.92
R7273:Zdbf2	UTSW	1	63303404	missense	possibly damaging	0.90
R7387:Zdbf2	UTSW	1	63304039	missense	possibly damaging	0.46
R7468:Zdbf2	UTSW	1	63307510	missense	probably benign
R7695:Zdbf2	UTSW	1	63307370	missense	possibly damaging	0.83
R7712:Zdbf2	UTSW	1	63305371	missense	possibly damaging	0.83
R7735:Zdbf2	UTSW	1	63304105	missense	possibly damaging	0.66
R7736:Zdbf2	UTSW	1	63308007	nonsense	probably null
R7759:Zdbf2	UTSW	1	63308376	missense	possibly damaging	0.46
R7796:Zdbf2	UTSW	1	63303424	missense	possibly damaging	0.90
R7908:Zdbf2	UTSW	1	63306827	missense	possibly damaging	0.46
R7970:Zdbf2	UTSW	1	63304171	missense	possibly damaging	0.92
R8076:Zdbf2	UTSW	1	63306101	missense	possibly damaging	0.92
R8152:Zdbf2	UTSW	1	63306413	missense	possibly damaging	0.92
R8195:Zdbf2	UTSW	1	63304066	missense	possibly damaging	0.83
R8272:Zdbf2	UTSW	1	63305983	missense	probably benign
R8306:Zdbf2	UTSW	1	63304075	missense	possibly damaging	0.66
R8309:Zdbf2	UTSW	1	63306591	missense	possibly damaging	0.82
R8323:Zdbf2	UTSW	1	63302914	missense	possibly damaging	0.46
R8400:Zdbf2	UTSW	1	63304976	missense	possibly damaging	0.92
R8443:Zdbf2	UTSW	1	63306007	missense	possibly damaging	0.83
R8460:Zdbf2	UTSW	1	63309570	small deletion	probably benign
R8528:Zdbf2	UTSW	1	63303386	missense	possibly damaging	0.82
R8812:Zdbf2	UTSW	1	63308113	missense	probably benign	0.00
R8962:Zdbf2	UTSW	1	63308003	missense	probably benign	0.00
R9061:Zdbf2	UTSW	1	63307137	missense
R9072:Zdbf2	UTSW	1	63305764	missense	possibly damaging	0.83
R9232:Zdbf2	UTSW	1	63308009	missense	possibly damaging	0.66
R9257:Zdbf2	UTSW	1	63306241	missense	probably damaging	1.00
R9411:Zdbf2	UTSW	1	63304129	missense	probably damaging	0.97
R9470:Zdbf2	UTSW	1	63305625	missense	possibly damaging	0.82
R9606:Zdbf2	UTSW	1	63303377	missense	possibly damaging	0.92
R9621:Zdbf2	UTSW	1	63303476	missense	possibly damaging	0.66
RF021:Zdbf2	UTSW	1	63302652	missense	possibly damaging	0.82
X0018:Zdbf2	UTSW	1	63305351	missense	possibly damaging	0.92
X0027:Zdbf2	UTSW	1	63308007	nonsense	probably null
X0057:Zdbf2	UTSW	1	63305390	missense	possibly damaging	0.66
X0063:Zdbf2	UTSW	1	63305537	missense	probably benign	0.04
Z1176:Zdbf2	UTSW	1	63304245	missense	possibly damaging	0.83
Z1177:Zdbf2	UTSW	1	63304086	frame shift	probably null
Z1177:Zdbf2	UTSW	1	63309203	missense	unknown

Predicted Primers

PCR Primer
(F):5'- TGCAGTTTTGTATGTCCAGGAGCC -3'
(R):5'- ACTAGTTGTAGCCTGAACAACACCG -3'

Sequencing Primer
(F):5'- CCAGGAGCCATTTGTTTATGAAAGAG -3'
(R):5'- ACTCTCAACTTTATGAGCCAATTC -3'

Posted On

2014-05-14