Incidental Mutation 'R1700:Sphkap'
ID189618
Institutional Source Beutler Lab
Gene Symbol Sphkap
Ensembl Gene ENSMUSG00000026163
Gene NameSPHK1 interactor, AKAP domain containing
Synonyms4930544G21Rik, A930009L15Rik, SKIP
MMRRC Submission 039733-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R1700 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location83254139-83408200 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 83277515 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 838 (R838*)
Ref Sequence ENSEMBL: ENSMUSP00000124872 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159078] [ENSMUST00000160953]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000053075
Predicted Effect probably null
Transcript: ENSMUST00000159078
AA Change: R551*
SMART Domains Protein: ENSMUSP00000124384
Gene: ENSMUSG00000026163
AA Change: R551*

DomainStartEndE-ValueType
low complexity region 303 314 N/A INTRINSIC
SCOP:d1ash__ 382 462 5e-3 SMART
low complexity region 809 819 N/A INTRINSIC
low complexity region 854 865 N/A INTRINSIC
low complexity region 1202 1221 N/A INTRINSIC
low complexity region 1243 1254 N/A INTRINSIC
Pfam:AKAP_110 1281 1398 7.5e-13 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000160953
AA Change: R838*
SMART Domains Protein: ENSMUSP00000124872
Gene: ENSMUSG00000026163
AA Change: R838*

DomainStartEndE-ValueType
low complexity region 590 601 N/A INTRINSIC
SCOP:d1ash__ 669 749 6e-3 SMART
low complexity region 1096 1106 N/A INTRINSIC
low complexity region 1141 1152 N/A INTRINSIC
low complexity region 1489 1508 N/A INTRINSIC
Pfam:AKAP_110 1540 1655 6.4e-12 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik G A 2: 130,709,938 L1010F probably damaging Het
Abcb1b T C 5: 8,849,537 F936L probably benign Het
Adamts12 T A 15: 11,152,057 I211N probably benign Het
Adamts16 G A 13: 70,779,518 probably benign Het
Alas1 C T 9: 106,239,646 V293I possibly damaging Het
Ap1g1 T C 8: 109,853,612 Y569H probably damaging Het
Apc2 A G 10: 80,312,769 D1190G probably damaging Het
Astn2 G A 4: 65,746,354 Q679* probably null Het
Atp2a1 T A 7: 126,462,909 H5L probably damaging Het
Baiap3 T C 17: 25,249,328 K279E probably damaging Het
C2cd2l G A 9: 44,316,612 P111S probably benign Het
C7 T A 15: 5,002,792 K646* probably null Het
Ccp110 C T 7: 118,735,313 T1003I probably damaging Het
Cdh22 T C 2: 165,170,796 D123G probably damaging Het
Cep295 C T 9: 15,340,883 E397K probably damaging Het
Clip1 A G 5: 123,630,370 V722A probably benign Het
Cpsf4l A G 11: 113,702,075 F174S probably benign Het
Ctnna3 T C 10: 63,852,772 C332R probably damaging Het
Cxcl10 A T 5: 92,347,855 N76K probably damaging Het
Dnaja3 G A 16: 4,684,165 R11K probably null Het
Efcab10 A G 12: 33,395,171 T28A possibly damaging Het
Esrrg A G 1: 188,043,653 R103G probably damaging Het
Exosc2 A G 2: 31,670,806 K23E probably benign Het
Flot2 C T 11: 78,049,547 S40L possibly damaging Het
Fsip2 T C 2: 82,991,737 V5938A probably benign Het
Gclc A G 9: 77,776,289 T143A probably benign Het
Gpr37 A G 6: 25,669,624 V407A probably benign Het
Gucy2e A T 11: 69,232,058 M497K probably benign Het
Herc1 T A 9: 66,450,678 probably null Het
Hnrnpll A C 17: 80,034,105 S502A probably benign Het
Ipo11 G T 13: 106,795,662 T975N probably benign Het
Kif17 C T 4: 138,262,698 Q66* probably null Het
Lrp10 T C 14: 54,469,752 V682A possibly damaging Het
Lsmem1 A T 12: 40,180,678 L75Q probably damaging Het
Med16 A T 10: 79,899,335 Y430N probably benign Het
Med8 C T 4: 118,412,734 S72L possibly damaging Het
Mex3a A G 3: 88,536,375 T253A probably damaging Het
Myf6 T C 10: 107,493,359 K242E probably damaging Het
Ncald T A 15: 37,397,343 Y31F probably benign Het
Ndufa12 T A 10: 94,199,993 Y48N probably damaging Het
Olfr1111 T G 2: 87,149,779 N294T probably damaging Het
Olfr1145 T C 2: 87,810,768 V316A probably benign Het
Olfr638 T A 7: 104,004,122 Y282* probably null Het
Pde4dip T C 3: 97,703,323 T1858A probably benign Het
Pgbd1 A G 13: 21,434,481 L2P probably damaging Het
Piezo1 C T 8: 122,487,502 R1642H probably damaging Het
Plxna1 A T 6: 89,357,008 M213K probably damaging Het
Polr1b A G 2: 129,123,121 N709S probably damaging Het
Pramel1 T A 4: 143,398,429 W308R probably damaging Het
Prkag2 A T 5: 24,871,541 I208N probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rngtt T A 4: 33,330,864 F156I probably damaging Het
Rpusd3 A G 6: 113,415,533 *345Q probably null Het
Rrp1b A G 17: 32,057,204 K575R probably benign Het
Shd G A 17: 55,974,307 V250I probably damaging Het
Slc12a5 C A 2: 164,992,376 N749K possibly damaging Het
Sorbs2 T A 8: 45,800,984 V488D probably damaging Het
Srsf4 C A 4: 131,900,560 probably benign Het
Strn T C 17: 78,692,402 Y135C probably damaging Het
Synm T C 7: 67,759,628 M1V probably null Het
Tas1r3 T G 4: 155,861,570 Q489P probably benign Het
Tas2r103 A T 6: 133,036,811 N97K probably damaging Het
Tas2r113 A G 6: 132,893,792 Y261C possibly damaging Het
Tex21 T C 12: 76,221,672 E112G probably damaging Het
Trappc8 T C 18: 20,832,998 S1128G probably damaging Het
Ubap1l A G 9: 65,371,743 probably benign Het
Ubash3a A G 17: 31,215,044 D121G probably damaging Het
Ubxn4 A G 1: 128,252,286 I56V possibly damaging Het
Uri1 T C 7: 37,963,524 I348M probably damaging Het
Usp21 C A 1: 171,283,722 L379F probably damaging Het
Vmn1r159 T A 7: 22,842,965 H214L probably damaging Het
Zdbf2 A G 1: 63,302,741 E93G unknown Het
Other mutations in Sphkap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Sphkap APN 1 83280516 missense probably damaging 1.00
IGL00337:Sphkap APN 1 83339608 missense probably damaging 1.00
IGL00470:Sphkap APN 1 83277910 missense possibly damaging 0.87
IGL00577:Sphkap APN 1 83278844 missense probably damaging 1.00
IGL00657:Sphkap APN 1 83276375 missense probably damaging 1.00
IGL01868:Sphkap APN 1 83280399 unclassified probably null
IGL02101:Sphkap APN 1 83290987 missense probably damaging 1.00
IGL02471:Sphkap APN 1 83276176 missense probably damaging 1.00
IGL02943:Sphkap APN 1 83276831 missense probably damaging 1.00
IGL02945:Sphkap APN 1 83276831 missense probably damaging 1.00
IGL03008:Sphkap APN 1 83276831 missense probably damaging 1.00
IGL03031:Sphkap APN 1 83276831 missense probably damaging 1.00
IGL03059:Sphkap APN 1 83257242 missense probably damaging 0.97
IGL03085:Sphkap APN 1 83280354 missense possibly damaging 0.92
IGL03355:Sphkap APN 1 83280503 missense probably damaging 1.00
IGL03356:Sphkap APN 1 83276831 missense probably damaging 1.00
IGL03368:Sphkap APN 1 83275676 missense probably benign 0.14
R0294:Sphkap UTSW 1 83278245 missense possibly damaging 0.72
R0308:Sphkap UTSW 1 83276969 missense probably damaging 1.00
R0478:Sphkap UTSW 1 83278711 missense probably damaging 1.00
R0606:Sphkap UTSW 1 83280424 missense probably damaging 1.00
R0678:Sphkap UTSW 1 83278628 missense probably benign 0.03
R1216:Sphkap UTSW 1 83290977 missense probably damaging 1.00
R1253:Sphkap UTSW 1 83278898 missense possibly damaging 0.56
R1532:Sphkap UTSW 1 83257203 missense probably damaging 1.00
R1635:Sphkap UTSW 1 83278400 missense probably benign 0.03
R1655:Sphkap UTSW 1 83277515 nonsense probably null
R1657:Sphkap UTSW 1 83277515 nonsense probably null
R1701:Sphkap UTSW 1 83277515 nonsense probably null
R1734:Sphkap UTSW 1 83277515 nonsense probably null
R1736:Sphkap UTSW 1 83277515 nonsense probably null
R1743:Sphkap UTSW 1 83277515 nonsense probably null
R1744:Sphkap UTSW 1 83277515 nonsense probably null
R1760:Sphkap UTSW 1 83277544 missense probably benign 0.29
R1893:Sphkap UTSW 1 83278966 missense probably benign 0.02
R1937:Sphkap UTSW 1 83267441 nonsense probably null
R1986:Sphkap UTSW 1 83277922 missense probably damaging 1.00
R1993:Sphkap UTSW 1 83277515 nonsense probably null
R1995:Sphkap UTSW 1 83277515 nonsense probably null
R2001:Sphkap UTSW 1 83276662 missense probably damaging 1.00
R2004:Sphkap UTSW 1 83277911 missense probably benign 0.04
R2111:Sphkap UTSW 1 83275881 missense probably benign 0.00
R2112:Sphkap UTSW 1 83275881 missense probably benign 0.00
R2156:Sphkap UTSW 1 83277989 missense probably benign 0.03
R2182:Sphkap UTSW 1 83276684 missense probably damaging 1.00
R2271:Sphkap UTSW 1 83257221 missense probably damaging 1.00
R3712:Sphkap UTSW 1 83277112 missense probably benign 0.27
R3919:Sphkap UTSW 1 83276458 missense probably damaging 1.00
R3980:Sphkap UTSW 1 83267494 splice site probably null
R4130:Sphkap UTSW 1 83277898 missense probably damaging 0.96
R4539:Sphkap UTSW 1 83277793 missense probably benign 0.00
R4602:Sphkap UTSW 1 83279061 nonsense probably null
R4735:Sphkap UTSW 1 83279117 missense probably benign 0.01
R4793:Sphkap UTSW 1 83278084 missense possibly damaging 0.77
R4849:Sphkap UTSW 1 83277384 missense probably benign 0.03
R4880:Sphkap UTSW 1 83288817 missense probably damaging 1.00
R5213:Sphkap UTSW 1 83280503 missense probably damaging 1.00
R5277:Sphkap UTSW 1 83276164 missense probably benign 0.04
R5331:Sphkap UTSW 1 83276782 missense probably benign 0.08
R5632:Sphkap UTSW 1 83278285 missense probably benign 0.01
R5647:Sphkap UTSW 1 83407999 missense probably damaging 0.98
R5751:Sphkap UTSW 1 83275897 missense probably benign 0.27
R5935:Sphkap UTSW 1 83339599 missense probably damaging 1.00
R5999:Sphkap UTSW 1 83267405 missense probably benign 0.02
R6232:Sphkap UTSW 1 83280479 missense probably damaging 1.00
R6318:Sphkap UTSW 1 83278378 missense probably damaging 1.00
R6474:Sphkap UTSW 1 83278823 missense probably damaging 1.00
R6602:Sphkap UTSW 1 83275758 missense possibly damaging 0.75
R6674:Sphkap UTSW 1 83277834 missense probably benign 0.37
R6716:Sphkap UTSW 1 83362228 critical splice donor site probably null
R6803:Sphkap UTSW 1 83280510 missense probably damaging 1.00
R6880:Sphkap UTSW 1 83257257 missense probably damaging 1.00
R6941:Sphkap UTSW 1 83408090 start gained probably benign
R7170:Sphkap UTSW 1 83265985 missense probably damaging 0.99
R7263:Sphkap UTSW 1 83276678 missense probably damaging 1.00
R7422:Sphkap UTSW 1 83263826 missense probably benign 0.02
R7640:Sphkap UTSW 1 83278928 missense possibly damaging 0.94
R7722:Sphkap UTSW 1 83278921 missense probably benign 0.00
R7810:Sphkap UTSW 1 83276300 missense probably damaging 1.00
R7887:Sphkap UTSW 1 83277412 missense probably benign 0.00
R7970:Sphkap UTSW 1 83277412 missense probably benign 0.00
Z1088:Sphkap UTSW 1 83276608 missense probably damaging 1.00
Z1088:Sphkap UTSW 1 83278604 missense probably damaging 1.00
Z1176:Sphkap UTSW 1 83276033 nonsense probably null
Z1176:Sphkap UTSW 1 83280442 missense possibly damaging 0.61
Z1177:Sphkap UTSW 1 83276431 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ATAGACCTCGGACTGCTTTGCCTC -3'
(R):5'- AGCCAGCCTCTTAGCAATGCAC -3'

Sequencing Primer
(F):5'- TCTAGAGTAGACTGAGCAGGAAC -3'
(R):5'- ACTGGCCTTGTCATCAGGAATC -3'
Posted On2014-05-14