Incidental Mutation 'R1700:Esrrg'
ID 189621
Institutional Source Beutler Lab
Gene Symbol Esrrg
Ensembl Gene ENSMUSG00000026610
Gene Name estrogen-related receptor gamma
Synonyms ERR3, estrogen-related receptor 3, Errg, NR3B3
MMRRC Submission 039733-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1700 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 187340988-187947082 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 187775850 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 103 (R103G)
Ref Sequence ENSEMBL: ENSMUSP00000106564 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027906] [ENSMUST00000110938] [ENSMUST00000110939] [ENSMUST00000127489]
AlphaFold P62509
Predicted Effect probably damaging
Transcript: ENSMUST00000027906
AA Change: R126G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000027906
Gene: ENSMUSG00000026610
AA Change: R126G

DomainStartEndE-ValueType
low complexity region 57 70 N/A INTRINSIC
ZnF_C4 125 196 4.04e-40 SMART
Blast:HOLI 203 233 5e-6 BLAST
HOLI 270 428 1.64e-40 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110938
AA Change: R103G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106563
Gene: ENSMUSG00000026610
AA Change: R103G

DomainStartEndE-ValueType
low complexity region 34 47 N/A INTRINSIC
ZnF_C4 102 173 4.04e-40 SMART
Blast:HOLI 180 210 4e-6 BLAST
HOLI 247 405 1.64e-40 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110939
AA Change: R103G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106564
Gene: ENSMUSG00000026610
AA Change: R103G

DomainStartEndE-ValueType
low complexity region 34 47 N/A INTRINSIC
ZnF_C4 102 173 4.04e-40 SMART
Blast:HOLI 180 210 4e-6 BLAST
HOLI 247 405 1.64e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127489
SMART Domains Protein: ENSMUSP00000119286
Gene: ENSMUSG00000026610

DomainStartEndE-ValueType
low complexity region 34 47 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the estrogen receptor-related receptor (ESRR) family, which belongs to the nuclear hormone receptor superfamily. All members of the ESRR family share an almost identical DNA binding domain, which is composed of two C4-type zinc finger motifs. The ESRR members are orphan nuclear receptors; they bind to the estrogen response element and steroidogenic factor 1 response element, and activate genes controlled by both response elements in the absence of any ligands. The ESRR family is closely related to the estrogen receptor (ER) family. They share target genes, co-regulators and promoters, and by targeting the same set of genes, the ESRRs seem to interfere with the ER-mediated estrogen response in various ways. It has been reported that the family member encoded by this gene functions as a transcriptional activator of DNA cytosine-5-methyltransferases 1 (Dnmt1) expression by direct binding to its response elements in the DNMT1 promoters, modulates cell proliferation and estrogen signaling in breast cancer, and negatively regulates bone morphogenetic protein 2-induced osteoblast differentiation and bone formation. Multiple alternatively spliced transcript variants have been identified, which mainly differ at the 5' end and some of which encode protein isoforms differing in the N-terminal region. [provided by RefSeq, Aug 2011]
PHENOTYPE: Nullizygous mutations lead to postnatal lethality. Homozygotes for a null allele show reduced birth weight, fasting hyperlactatemia, altered electrocardiograms and mitochondrial function, and agenesis of the renal papilla. Surviving homozygotes for a different null allele exhibit hearing loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T C 5: 8,899,537 (GRCm39) F936L probably benign Het
Adamts12 T A 15: 11,152,143 (GRCm39) I211N probably benign Het
Adamts16 G A 13: 70,927,637 (GRCm39) probably benign Het
Alas1 C T 9: 106,116,845 (GRCm39) V293I possibly damaging Het
Ap1g1 T C 8: 110,580,244 (GRCm39) Y569H probably damaging Het
Apc2 A G 10: 80,148,603 (GRCm39) D1190G probably damaging Het
Astn2 G A 4: 65,664,591 (GRCm39) Q679* probably null Het
Atp2a1 T A 7: 126,062,081 (GRCm39) H5L probably damaging Het
Baiap3 T C 17: 25,468,302 (GRCm39) K279E probably damaging Het
C2cd2l G A 9: 44,227,909 (GRCm39) P111S probably benign Het
C7 T A 15: 5,032,274 (GRCm39) K646* probably null Het
Ccp110 C T 7: 118,334,536 (GRCm39) T1003I probably damaging Het
Cdh22 T C 2: 165,012,716 (GRCm39) D123G probably damaging Het
Cep295 C T 9: 15,252,179 (GRCm39) E397K probably damaging Het
Clip1 A G 5: 123,768,433 (GRCm39) V722A probably benign Het
Cpsf4l A G 11: 113,592,901 (GRCm39) F174S probably benign Het
Ctnna3 T C 10: 63,688,551 (GRCm39) C332R probably damaging Het
Cxcl10 A T 5: 92,495,714 (GRCm39) N76K probably damaging Het
Dnaaf9 G A 2: 130,551,858 (GRCm39) L1010F probably damaging Het
Dnaja3 G A 16: 4,502,029 (GRCm39) R11K probably null Het
Efcab10 A G 12: 33,445,170 (GRCm39) T28A possibly damaging Het
Exosc2 A G 2: 31,560,818 (GRCm39) K23E probably benign Het
Flot2 C T 11: 77,940,373 (GRCm39) S40L possibly damaging Het
Fsip2 T C 2: 82,822,081 (GRCm39) V5938A probably benign Het
Gclc A G 9: 77,683,571 (GRCm39) T143A probably benign Het
Gpr37 A G 6: 25,669,623 (GRCm39) V407A probably benign Het
Gucy2e A T 11: 69,122,884 (GRCm39) M497K probably benign Het
Herc1 T A 9: 66,357,960 (GRCm39) probably null Het
Hnrnpll A C 17: 80,341,534 (GRCm39) S502A probably benign Het
Ipo11 G T 13: 106,932,170 (GRCm39) T975N probably benign Het
Kif17 C T 4: 137,990,009 (GRCm39) Q66* probably null Het
Lrp10 T C 14: 54,707,209 (GRCm39) V682A possibly damaging Het
Lsmem1 A T 12: 40,230,677 (GRCm39) L75Q probably damaging Het
Med16 A T 10: 79,735,169 (GRCm39) Y430N probably benign Het
Med8 C T 4: 118,269,931 (GRCm39) S72L possibly damaging Het
Mex3a A G 3: 88,443,682 (GRCm39) T253A probably damaging Het
Myf6 T C 10: 107,329,220 (GRCm39) K242E probably damaging Het
Ncald T A 15: 37,397,587 (GRCm39) Y31F probably benign Het
Ndufa12 T A 10: 94,035,855 (GRCm39) Y48N probably damaging Het
Or12e10 T C 2: 87,641,112 (GRCm39) V316A probably benign Het
Or51q1c T A 7: 103,653,329 (GRCm39) Y282* probably null Het
Or5as1 T G 2: 86,980,123 (GRCm39) N294T probably damaging Het
Pde4dip T C 3: 97,610,639 (GRCm39) T1858A probably benign Het
Pgbd1 A G 13: 21,618,651 (GRCm39) L2P probably damaging Het
Piezo1 C T 8: 123,214,241 (GRCm39) R1642H probably damaging Het
Plxna1 A T 6: 89,333,990 (GRCm39) M213K probably damaging Het
Polr1b A G 2: 128,965,041 (GRCm39) N709S probably damaging Het
Pramel1 T A 4: 143,124,999 (GRCm39) W308R probably damaging Het
Prkag2 A T 5: 25,076,539 (GRCm39) I208N probably damaging Het
Ptpro T A 6: 137,420,592 (GRCm39) V1007D probably damaging Het
Rngtt T A 4: 33,330,864 (GRCm39) F156I probably damaging Het
Rpusd3 A G 6: 113,392,494 (GRCm39) *345Q probably null Het
Rrp1b A G 17: 32,276,178 (GRCm39) K575R probably benign Het
Shd G A 17: 56,281,307 (GRCm39) V250I probably damaging Het
Slc12a5 C A 2: 164,834,296 (GRCm39) N749K possibly damaging Het
Sorbs2 T A 8: 46,254,021 (GRCm39) V488D probably damaging Het
Sphkap G A 1: 83,255,236 (GRCm39) R838* probably null Het
Srsf4 C A 4: 131,627,871 (GRCm39) probably benign Het
Strn T C 17: 78,999,831 (GRCm39) Y135C probably damaging Het
Synm T C 7: 67,409,376 (GRCm39) M1V probably null Het
Tas1r3 T G 4: 155,946,027 (GRCm39) Q489P probably benign Het
Tas2r103 A T 6: 133,013,774 (GRCm39) N97K probably damaging Het
Tas2r113 A G 6: 132,870,755 (GRCm39) Y261C possibly damaging Het
Tex21 T C 12: 76,268,446 (GRCm39) E112G probably damaging Het
Trappc8 T C 18: 20,966,055 (GRCm39) S1128G probably damaging Het
Ubap1l A G 9: 65,279,025 (GRCm39) probably benign Het
Ubash3a A G 17: 31,434,018 (GRCm39) D121G probably damaging Het
Ubxn4 A G 1: 128,180,023 (GRCm39) I56V possibly damaging Het
Uri1 T C 7: 37,662,949 (GRCm39) I348M probably damaging Het
Usp21 C A 1: 171,111,295 (GRCm39) L379F probably damaging Het
Vmn1r159 T A 7: 22,542,390 (GRCm39) H214L probably damaging Het
Zdbf2 A G 1: 63,341,900 (GRCm39) E93G unknown Het
Other mutations in Esrrg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Esrrg APN 1 187,943,107 (GRCm39) missense probably damaging 1.00
IGL01635:Esrrg APN 1 187,930,797 (GRCm39) missense probably damaging 1.00
IGL01642:Esrrg APN 1 187,943,112 (GRCm39) missense probably benign 0.01
IGL02740:Esrrg APN 1 187,930,938 (GRCm39) missense probably benign 0.04
IGL03126:Esrrg APN 1 187,730,184 (GRCm39) intron probably benign
IGL03391:Esrrg APN 1 187,882,420 (GRCm39) missense possibly damaging 0.70
R0395:Esrrg UTSW 1 187,930,832 (GRCm39) missense probably damaging 1.00
R0645:Esrrg UTSW 1 187,775,538 (GRCm39) missense probably benign 0.00
R1593:Esrrg UTSW 1 187,798,582 (GRCm39) missense possibly damaging 0.94
R1855:Esrrg UTSW 1 187,943,295 (GRCm39) missense probably damaging 1.00
R3552:Esrrg UTSW 1 187,882,387 (GRCm39) missense probably benign 0.05
R3605:Esrrg UTSW 1 187,943,299 (GRCm39) missense possibly damaging 0.74
R4384:Esrrg UTSW 1 187,775,908 (GRCm39) missense probably damaging 1.00
R5255:Esrrg UTSW 1 187,878,555 (GRCm39) missense probably damaging 1.00
R5443:Esrrg UTSW 1 187,775,622 (GRCm39) missense possibly damaging 0.78
R5511:Esrrg UTSW 1 187,943,304 (GRCm39) missense probably damaging 1.00
R5516:Esrrg UTSW 1 187,930,927 (GRCm39) missense possibly damaging 0.56
R5543:Esrrg UTSW 1 187,882,451 (GRCm39) missense probably damaging 0.96
R5686:Esrrg UTSW 1 187,882,395 (GRCm39) missense probably benign 0.24
R5990:Esrrg UTSW 1 187,930,995 (GRCm39) missense probably damaging 1.00
R6030:Esrrg UTSW 1 187,930,904 (GRCm39) missense probably benign 0.04
R6030:Esrrg UTSW 1 187,930,904 (GRCm39) missense probably benign 0.04
R7058:Esrrg UTSW 1 187,882,503 (GRCm39) missense probably damaging 1.00
R7487:Esrrg UTSW 1 187,878,620 (GRCm39) missense probably benign 0.03
R8512:Esrrg UTSW 1 187,775,777 (GRCm39) nonsense probably null
R8735:Esrrg UTSW 1 187,933,205 (GRCm39) intron probably benign
R8973:Esrrg UTSW 1 187,930,947 (GRCm39) missense possibly damaging 0.79
R8986:Esrrg UTSW 1 187,943,104 (GRCm39) missense possibly damaging 0.60
R9114:Esrrg UTSW 1 187,878,606 (GRCm39) missense possibly damaging 0.75
R9114:Esrrg UTSW 1 187,878,605 (GRCm39) missense probably benign 0.01
R9483:Esrrg UTSW 1 187,930,848 (GRCm39) missense probably damaging 0.97
R9760:Esrrg UTSW 1 187,775,569 (GRCm39) missense probably benign
Z1088:Esrrg UTSW 1 187,882,415 (GRCm39) missense probably benign 0.04
Z1177:Esrrg UTSW 1 187,775,752 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTCCTTCATCAAGACGGAACCCTC -3'
(R):5'- CAACCTACTATGCACTGCTCAGCTC -3'

Sequencing Primer
(F):5'- CAGTGGGAGTTACAGTTCAACC -3'
(R):5'- CAGACCTACTATGCTCTCTGAAATG -3'
Posted On 2014-05-14