Incidental Mutation 'R1700:Slc12a5'
ID189629
Institutional Source Beutler Lab
Gene Symbol Slc12a5
Ensembl Gene ENSMUSG00000017740
Gene Namesolute carrier family 12, member 5
SynonymsKCC2
MMRRC Submission 039733-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1700 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location164960802-164999731 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 164992376 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 749 (N749K)
Ref Sequence ENSEMBL: ENSMUSP00000096690 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099092] [ENSMUST00000202136] [ENSMUST00000202223] [ENSMUST00000202479] [ENSMUST00000202623]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099092
AA Change: N749K

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000096690
Gene: ENSMUSG00000017740
AA Change: N749K

DomainStartEndE-ValueType
low complexity region 10 22 N/A INTRINSIC
low complexity region 77 90 N/A INTRINSIC
Pfam:AA_permease 102 304 5.2e-22 PFAM
Pfam:AA_permease_2 364 632 1e-17 PFAM
Pfam:AA_permease 389 676 1.9e-42 PFAM
Pfam:SLC12 688 814 2.1e-19 PFAM
Pfam:SLC12 807 959 1.8e-20 PFAM
low complexity region 978 1002 N/A INTRINSIC
Pfam:SLC12 1009 1115 2.1e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137302
Predicted Effect probably benign
Transcript: ENSMUST00000202136
SMART Domains Protein: ENSMUSP00000143973
Gene: ENSMUSG00000017740

DomainStartEndE-ValueType
low complexity region 10 22 N/A INTRINSIC
low complexity region 77 90 N/A INTRINSIC
Pfam:AA_permease 102 175 2.5e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202223
AA Change: N772K

PolyPhen 2 Score 0.238 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000143870
Gene: ENSMUSG00000017740
AA Change: N772K

DomainStartEndE-ValueType
low complexity region 11 19 N/A INTRINSIC
low complexity region 100 113 N/A INTRINSIC
Pfam:AA_permease 125 327 1e-19 PFAM
Pfam:AA_permease_2 386 655 4.5e-15 PFAM
Pfam:AA_permease 412 699 3.7e-40 PFAM
Pfam:SLC12 711 837 7.2e-17 PFAM
Pfam:SLC12 830 982 6.2e-18 PFAM
low complexity region 1001 1025 N/A INTRINSIC
Pfam:SLC12 1030 1133 8.6e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202479
SMART Domains Protein: ENSMUSP00000144540
Gene: ENSMUSG00000017740

DomainStartEndE-ValueType
low complexity region 10 22 N/A INTRINSIC
low complexity region 77 90 N/A INTRINSIC
Pfam:AA_permease 102 176 5.2e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202623
AA Change: N772K

PolyPhen 2 Score 0.238 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000144623
Gene: ENSMUSG00000017740
AA Change: N772K

DomainStartEndE-ValueType
low complexity region 11 19 N/A INTRINSIC
low complexity region 100 113 N/A INTRINSIC
Pfam:AA_permease 125 327 5.3e-22 PFAM
Pfam:AA_permease_2 386 655 1.2e-17 PFAM
Pfam:AA_permease 412 699 2e-42 PFAM
Pfam:SLC12 711 837 2.1e-19 PFAM
Pfam:SLC12 830 982 1.8e-20 PFAM
low complexity region 1001 1025 N/A INTRINSIC
Pfam:SLC12 1032 1138 2.2e-15 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] K-Cl cotransporters are proteins that lower intracellular chloride concentrations below the electrochemical equilibrium potential. The protein encoded by this gene is an integral membrane K-Cl cotransporter that can function in either a net efflux or influx pathway, depending on the chemical concentration gradients of potassium and chloride. The encoded protein can act as a homomultimer, or as a heteromultimer with other K-Cl cotransporters, to maintain chloride homeostasis in neurons. Alternative splicing results in two transcript variants encoding different isoforms. [provided by RefSeq, Sep 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene die within a few minutes of birth of respiratory failure resulting from a motor nerve defect. Mice homozygous for a hypomorphic allele display postnatal lethality and tonic-clonic seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik G A 2: 130,709,938 L1010F probably damaging Het
Abcb1b T C 5: 8,849,537 F936L probably benign Het
Adamts12 T A 15: 11,152,057 I211N probably benign Het
Adamts16 G A 13: 70,779,518 probably benign Het
Alas1 C T 9: 106,239,646 V293I possibly damaging Het
Ap1g1 T C 8: 109,853,612 Y569H probably damaging Het
Apc2 A G 10: 80,312,769 D1190G probably damaging Het
Astn2 G A 4: 65,746,354 Q679* probably null Het
Atp2a1 T A 7: 126,462,909 H5L probably damaging Het
Baiap3 T C 17: 25,249,328 K279E probably damaging Het
C2cd2l G A 9: 44,316,612 P111S probably benign Het
C7 T A 15: 5,002,792 K646* probably null Het
Ccp110 C T 7: 118,735,313 T1003I probably damaging Het
Cdh22 T C 2: 165,170,796 D123G probably damaging Het
Cep295 C T 9: 15,340,883 E397K probably damaging Het
Clip1 A G 5: 123,630,370 V722A probably benign Het
Cpsf4l A G 11: 113,702,075 F174S probably benign Het
Ctnna3 T C 10: 63,852,772 C332R probably damaging Het
Cxcl10 A T 5: 92,347,855 N76K probably damaging Het
Dnaja3 G A 16: 4,684,165 R11K probably null Het
Efcab10 A G 12: 33,395,171 T28A possibly damaging Het
Esrrg A G 1: 188,043,653 R103G probably damaging Het
Exosc2 A G 2: 31,670,806 K23E probably benign Het
Flot2 C T 11: 78,049,547 S40L possibly damaging Het
Fsip2 T C 2: 82,991,737 V5938A probably benign Het
Gclc A G 9: 77,776,289 T143A probably benign Het
Gpr37 A G 6: 25,669,624 V407A probably benign Het
Gucy2e A T 11: 69,232,058 M497K probably benign Het
Herc1 T A 9: 66,450,678 probably null Het
Hnrnpll A C 17: 80,034,105 S502A probably benign Het
Ipo11 G T 13: 106,795,662 T975N probably benign Het
Kif17 C T 4: 138,262,698 Q66* probably null Het
Lrp10 T C 14: 54,469,752 V682A possibly damaging Het
Lsmem1 A T 12: 40,180,678 L75Q probably damaging Het
Med16 A T 10: 79,899,335 Y430N probably benign Het
Med8 C T 4: 118,412,734 S72L possibly damaging Het
Mex3a A G 3: 88,536,375 T253A probably damaging Het
Myf6 T C 10: 107,493,359 K242E probably damaging Het
Ncald T A 15: 37,397,343 Y31F probably benign Het
Ndufa12 T A 10: 94,199,993 Y48N probably damaging Het
Olfr1111 T G 2: 87,149,779 N294T probably damaging Het
Olfr1145 T C 2: 87,810,768 V316A probably benign Het
Olfr638 T A 7: 104,004,122 Y282* probably null Het
Pde4dip T C 3: 97,703,323 T1858A probably benign Het
Pgbd1 A G 13: 21,434,481 L2P probably damaging Het
Piezo1 C T 8: 122,487,502 R1642H probably damaging Het
Plxna1 A T 6: 89,357,008 M213K probably damaging Het
Polr1b A G 2: 129,123,121 N709S probably damaging Het
Pramel1 T A 4: 143,398,429 W308R probably damaging Het
Prkag2 A T 5: 24,871,541 I208N probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rngtt T A 4: 33,330,864 F156I probably damaging Het
Rpusd3 A G 6: 113,415,533 *345Q probably null Het
Rrp1b A G 17: 32,057,204 K575R probably benign Het
Shd G A 17: 55,974,307 V250I probably damaging Het
Sorbs2 T A 8: 45,800,984 V488D probably damaging Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Srsf4 C A 4: 131,900,560 probably benign Het
Strn T C 17: 78,692,402 Y135C probably damaging Het
Synm T C 7: 67,759,628 M1V probably null Het
Tas1r3 T G 4: 155,861,570 Q489P probably benign Het
Tas2r103 A T 6: 133,036,811 N97K probably damaging Het
Tas2r113 A G 6: 132,893,792 Y261C possibly damaging Het
Tex21 T C 12: 76,221,672 E112G probably damaging Het
Trappc8 T C 18: 20,832,998 S1128G probably damaging Het
Ubap1l A G 9: 65,371,743 probably benign Het
Ubash3a A G 17: 31,215,044 D121G probably damaging Het
Ubxn4 A G 1: 128,252,286 I56V possibly damaging Het
Uri1 T C 7: 37,963,524 I348M probably damaging Het
Usp21 C A 1: 171,283,722 L379F probably damaging Het
Vmn1r159 T A 7: 22,842,965 H214L probably damaging Het
Zdbf2 A G 1: 63,302,741 E93G unknown Het
Other mutations in Slc12a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Slc12a5 APN 2 164997121 missense probably damaging 1.00
IGL00425:Slc12a5 APN 2 164983281 missense probably damaging 1.00
IGL00976:Slc12a5 APN 2 164979304 missense probably damaging 1.00
IGL01654:Slc12a5 APN 2 164973755 missense possibly damaging 0.91
IGL01905:Slc12a5 APN 2 164990381 missense probably benign 0.02
IGL02205:Slc12a5 APN 2 164996479 missense probably benign 0.03
IGL02510:Slc12a5 APN 2 164982808 splice site probably benign
IGL02746:Slc12a5 APN 2 164974916 missense probably benign 0.01
R0051:Slc12a5 UTSW 2 164986663 missense probably damaging 1.00
R0254:Slc12a5 UTSW 2 164997245 critical splice donor site probably null
R0412:Slc12a5 UTSW 2 164994062 missense probably benign 0.05
R0587:Slc12a5 UTSW 2 164976533 missense probably damaging 1.00
R0835:Slc12a5 UTSW 2 164994038 missense probably damaging 0.97
R0932:Slc12a5 UTSW 2 164996885 splice site probably benign
R1643:Slc12a5 UTSW 2 164994027 missense probably benign 0.01
R1760:Slc12a5 UTSW 2 164996128 missense probably damaging 0.99
R2063:Slc12a5 UTSW 2 164997147 missense probably damaging 1.00
R2293:Slc12a5 UTSW 2 164992330 missense probably benign 0.03
R2412:Slc12a5 UTSW 2 164976462 critical splice donor site probably null
R3035:Slc12a5 UTSW 2 164980258 missense probably benign 0.06
R3116:Slc12a5 UTSW 2 164996181 intron probably null
R3412:Slc12a5 UTSW 2 164968431 missense probably benign 0.26
R3788:Slc12a5 UTSW 2 164993775 missense probably damaging 1.00
R4039:Slc12a5 UTSW 2 164992330 missense probably benign 0.03
R4174:Slc12a5 UTSW 2 164979490 missense probably damaging 1.00
R4492:Slc12a5 UTSW 2 164979343 missense probably benign 0.08
R4608:Slc12a5 UTSW 2 164973765 missense probably damaging 0.99
R4750:Slc12a5 UTSW 2 164982931 missense probably benign 0.06
R4994:Slc12a5 UTSW 2 164983365 intron probably null
R5103:Slc12a5 UTSW 2 164992433 missense probably damaging 1.00
R5539:Slc12a5 UTSW 2 164987206 missense possibly damaging 0.94
R5632:Slc12a5 UTSW 2 164987221 missense possibly damaging 0.86
R5771:Slc12a5 UTSW 2 164973768 missense possibly damaging 0.88
R6139:Slc12a5 UTSW 2 164992311 missense probably damaging 0.98
R6336:Slc12a5 UTSW 2 164992464 intron probably null
R6581:Slc12a5 UTSW 2 164987115 missense probably damaging 1.00
R6706:Slc12a5 UTSW 2 164988589 missense probably damaging 1.00
R6886:Slc12a5 UTSW 2 164982905 missense probably benign
R7134:Slc12a5 UTSW 2 164974958 missense probably damaging 1.00
R7310:Slc12a5 UTSW 2 164992440 missense probably damaging 1.00
R7402:Slc12a5 UTSW 2 164982932 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGCTTATCTGTGAGGAGCAGGAAC -3'
(R):5'- GCATGAGAGAAAGCCTCCACTTACC -3'

Sequencing Primer
(F):5'- CCTAGAGTTGGATAAGATCAGAGTTG -3'
(R):5'- cacacacacacacacacac -3'
Posted On2014-05-14