Incidental Mutation 'R1700:Pde4dip'
ID 189633
Institutional Source Beutler Lab
Gene Symbol Pde4dip
Ensembl Gene ENSMUSG00000038170
Gene Name phosphodiesterase 4D interacting protein (myomegalin)
Synonyms Usmg4, D3Bwg1078e, D130016K21Rik, 9430063L05Rik, 4732458A06Rik
MMRRC Submission 039733-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1700 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 97597144-97796023 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 97610639 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 1858 (T1858A)
Ref Sequence ENSEMBL: ENSMUSP00000131170 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090750] [ENSMUST00000168438]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000090750
AA Change: T1909A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000088254
Gene: ENSMUSG00000038170
AA Change: T1909A

DomainStartEndE-ValueType
low complexity region 10 40 N/A INTRINSIC
low complexity region 45 57 N/A INTRINSIC
Pfam:Cnn_1N 124 196 3.2e-26 PFAM
low complexity region 204 219 N/A INTRINSIC
coiled coil region 282 325 N/A INTRINSIC
internal_repeat_1 397 438 4.03e-5 PROSPERO
low complexity region 567 578 N/A INTRINSIC
internal_repeat_2 617 667 6.59e-5 PROSPERO
internal_repeat_1 620 661 4.03e-5 PROSPERO
coiled coil region 866 942 N/A INTRINSIC
low complexity region 1038 1056 N/A INTRINSIC
low complexity region 1067 1082 N/A INTRINSIC
coiled coil region 1118 1163 N/A INTRINSIC
coiled coil region 1336 1363 N/A INTRINSIC
low complexity region 1403 1420 N/A INTRINSIC
coiled coil region 1470 1508 N/A INTRINSIC
internal_repeat_2 1597 1644 6.59e-5 PROSPERO
DUF1220 1680 1747 1.17e-17 SMART
low complexity region 1758 1780 N/A INTRINSIC
low complexity region 1836 1851 N/A INTRINSIC
low complexity region 1860 1874 N/A INTRINSIC
low complexity region 1940 1951 N/A INTRINSIC
coiled coil region 1962 2138 N/A INTRINSIC
coiled coil region 2162 2197 N/A INTRINSIC
coiled coil region 2387 2431 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168438
AA Change: T1858A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000131170
Gene: ENSMUSG00000038170
AA Change: T1858A

DomainStartEndE-ValueType
low complexity region 10 40 N/A INTRINSIC
low complexity region 45 57 N/A INTRINSIC
Pfam:Microtub_assoc 124 198 1.4e-31 PFAM
low complexity region 204 219 N/A INTRINSIC
coiled coil region 282 325 N/A INTRINSIC
internal_repeat_1 397 438 3.56e-5 PROSPERO
low complexity region 567 578 N/A INTRINSIC
internal_repeat_2 617 667 5.83e-5 PROSPERO
internal_repeat_1 620 661 3.56e-5 PROSPERO
coiled coil region 866 942 N/A INTRINSIC
low complexity region 1038 1056 N/A INTRINSIC
low complexity region 1067 1082 N/A INTRINSIC
coiled coil region 1118 1163 N/A INTRINSIC
coiled coil region 1336 1363 N/A INTRINSIC
low complexity region 1403 1420 N/A INTRINSIC
coiled coil region 1470 1508 N/A INTRINSIC
internal_repeat_2 1597 1644 5.83e-5 PROSPERO
DUF1220 1680 1747 1.17e-17 SMART
low complexity region 1758 1769 N/A INTRINSIC
low complexity region 1785 1800 N/A INTRINSIC
low complexity region 1809 1823 N/A INTRINSIC
low complexity region 1889 1900 N/A INTRINSIC
coiled coil region 1911 2087 N/A INTRINSIC
coiled coil region 2111 2146 N/A INTRINSIC
coiled coil region 2336 2380 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene serves to anchor phosphodiesterase 4D to the Golgi/centrosome region of the cell. Defects in this gene may be a cause of myeloproliferative disorder (MBD) associated with eosinophilia. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit partial (in utero or perinatal) lethality, hyperactivity, and increased vertical activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T C 5: 8,899,537 (GRCm39) F936L probably benign Het
Adamts12 T A 15: 11,152,143 (GRCm39) I211N probably benign Het
Adamts16 G A 13: 70,927,637 (GRCm39) probably benign Het
Alas1 C T 9: 106,116,845 (GRCm39) V293I possibly damaging Het
Ap1g1 T C 8: 110,580,244 (GRCm39) Y569H probably damaging Het
Apc2 A G 10: 80,148,603 (GRCm39) D1190G probably damaging Het
Astn2 G A 4: 65,664,591 (GRCm39) Q679* probably null Het
Atp2a1 T A 7: 126,062,081 (GRCm39) H5L probably damaging Het
Baiap3 T C 17: 25,468,302 (GRCm39) K279E probably damaging Het
C2cd2l G A 9: 44,227,909 (GRCm39) P111S probably benign Het
C7 T A 15: 5,032,274 (GRCm39) K646* probably null Het
Ccp110 C T 7: 118,334,536 (GRCm39) T1003I probably damaging Het
Cdh22 T C 2: 165,012,716 (GRCm39) D123G probably damaging Het
Cep295 C T 9: 15,252,179 (GRCm39) E397K probably damaging Het
Clip1 A G 5: 123,768,433 (GRCm39) V722A probably benign Het
Cpsf4l A G 11: 113,592,901 (GRCm39) F174S probably benign Het
Ctnna3 T C 10: 63,688,551 (GRCm39) C332R probably damaging Het
Cxcl10 A T 5: 92,495,714 (GRCm39) N76K probably damaging Het
Dnaaf9 G A 2: 130,551,858 (GRCm39) L1010F probably damaging Het
Dnaja3 G A 16: 4,502,029 (GRCm39) R11K probably null Het
Efcab10 A G 12: 33,445,170 (GRCm39) T28A possibly damaging Het
Esrrg A G 1: 187,775,850 (GRCm39) R103G probably damaging Het
Exosc2 A G 2: 31,560,818 (GRCm39) K23E probably benign Het
Flot2 C T 11: 77,940,373 (GRCm39) S40L possibly damaging Het
Fsip2 T C 2: 82,822,081 (GRCm39) V5938A probably benign Het
Gclc A G 9: 77,683,571 (GRCm39) T143A probably benign Het
Gpr37 A G 6: 25,669,623 (GRCm39) V407A probably benign Het
Gucy2e A T 11: 69,122,884 (GRCm39) M497K probably benign Het
Herc1 T A 9: 66,357,960 (GRCm39) probably null Het
Hnrnpll A C 17: 80,341,534 (GRCm39) S502A probably benign Het
Ipo11 G T 13: 106,932,170 (GRCm39) T975N probably benign Het
Kif17 C T 4: 137,990,009 (GRCm39) Q66* probably null Het
Lrp10 T C 14: 54,707,209 (GRCm39) V682A possibly damaging Het
Lsmem1 A T 12: 40,230,677 (GRCm39) L75Q probably damaging Het
Med16 A T 10: 79,735,169 (GRCm39) Y430N probably benign Het
Med8 C T 4: 118,269,931 (GRCm39) S72L possibly damaging Het
Mex3a A G 3: 88,443,682 (GRCm39) T253A probably damaging Het
Myf6 T C 10: 107,329,220 (GRCm39) K242E probably damaging Het
Ncald T A 15: 37,397,587 (GRCm39) Y31F probably benign Het
Ndufa12 T A 10: 94,035,855 (GRCm39) Y48N probably damaging Het
Or12e10 T C 2: 87,641,112 (GRCm39) V316A probably benign Het
Or51q1c T A 7: 103,653,329 (GRCm39) Y282* probably null Het
Or5as1 T G 2: 86,980,123 (GRCm39) N294T probably damaging Het
Pgbd1 A G 13: 21,618,651 (GRCm39) L2P probably damaging Het
Piezo1 C T 8: 123,214,241 (GRCm39) R1642H probably damaging Het
Plxna1 A T 6: 89,333,990 (GRCm39) M213K probably damaging Het
Polr1b A G 2: 128,965,041 (GRCm39) N709S probably damaging Het
Pramel1 T A 4: 143,124,999 (GRCm39) W308R probably damaging Het
Prkag2 A T 5: 25,076,539 (GRCm39) I208N probably damaging Het
Ptpro T A 6: 137,420,592 (GRCm39) V1007D probably damaging Het
Rngtt T A 4: 33,330,864 (GRCm39) F156I probably damaging Het
Rpusd3 A G 6: 113,392,494 (GRCm39) *345Q probably null Het
Rrp1b A G 17: 32,276,178 (GRCm39) K575R probably benign Het
Shd G A 17: 56,281,307 (GRCm39) V250I probably damaging Het
Slc12a5 C A 2: 164,834,296 (GRCm39) N749K possibly damaging Het
Sorbs2 T A 8: 46,254,021 (GRCm39) V488D probably damaging Het
Sphkap G A 1: 83,255,236 (GRCm39) R838* probably null Het
Srsf4 C A 4: 131,627,871 (GRCm39) probably benign Het
Strn T C 17: 78,999,831 (GRCm39) Y135C probably damaging Het
Synm T C 7: 67,409,376 (GRCm39) M1V probably null Het
Tas1r3 T G 4: 155,946,027 (GRCm39) Q489P probably benign Het
Tas2r103 A T 6: 133,013,774 (GRCm39) N97K probably damaging Het
Tas2r113 A G 6: 132,870,755 (GRCm39) Y261C possibly damaging Het
Tex21 T C 12: 76,268,446 (GRCm39) E112G probably damaging Het
Trappc8 T C 18: 20,966,055 (GRCm39) S1128G probably damaging Het
Ubap1l A G 9: 65,279,025 (GRCm39) probably benign Het
Ubash3a A G 17: 31,434,018 (GRCm39) D121G probably damaging Het
Ubxn4 A G 1: 128,180,023 (GRCm39) I56V possibly damaging Het
Uri1 T C 7: 37,662,949 (GRCm39) I348M probably damaging Het
Usp21 C A 1: 171,111,295 (GRCm39) L379F probably damaging Het
Vmn1r159 T A 7: 22,542,390 (GRCm39) H214L probably damaging Het
Zdbf2 A G 1: 63,341,900 (GRCm39) E93G unknown Het
Other mutations in Pde4dip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Pde4dip APN 3 97,674,593 (GRCm39) missense probably benign 0.00
IGL00543:Pde4dip APN 3 97,664,940 (GRCm39) missense possibly damaging 0.91
IGL00979:Pde4dip APN 3 97,655,074 (GRCm39) splice site probably benign
IGL01483:Pde4dip APN 3 97,661,465 (GRCm39) missense probably damaging 1.00
IGL02122:Pde4dip APN 3 97,674,737 (GRCm39) missense probably damaging 1.00
IGL02398:Pde4dip APN 3 97,674,097 (GRCm39) missense probably benign
IGL02814:Pde4dip APN 3 97,674,416 (GRCm39) missense probably damaging 1.00
IGL02826:Pde4dip APN 3 97,674,403 (GRCm39) missense probably damaging 1.00
D3080:Pde4dip UTSW 3 97,674,146 (GRCm39) missense probably damaging 1.00
R0077:Pde4dip UTSW 3 97,660,442 (GRCm39) nonsense probably null
R0096:Pde4dip UTSW 3 97,674,783 (GRCm39) missense probably damaging 0.99
R0277:Pde4dip UTSW 3 97,751,028 (GRCm39) missense probably benign 0.01
R0304:Pde4dip UTSW 3 97,751,028 (GRCm39) missense probably benign 0.01
R0616:Pde4dip UTSW 3 97,654,849 (GRCm39) missense probably benign 0.09
R0676:Pde4dip UTSW 3 97,624,413 (GRCm39) splice site probably benign
R1166:Pde4dip UTSW 3 97,620,512 (GRCm39) missense possibly damaging 0.94
R1376:Pde4dip UTSW 3 97,650,533 (GRCm39) missense probably damaging 0.99
R1376:Pde4dip UTSW 3 97,650,533 (GRCm39) missense probably damaging 0.99
R1452:Pde4dip UTSW 3 97,631,418 (GRCm39) missense probably damaging 1.00
R1550:Pde4dip UTSW 3 97,627,020 (GRCm39) missense probably damaging 1.00
R1704:Pde4dip UTSW 3 97,661,576 (GRCm39) missense probably benign 0.28
R1769:Pde4dip UTSW 3 97,603,246 (GRCm39) missense probably benign 0.00
R1934:Pde4dip UTSW 3 97,600,007 (GRCm39) missense possibly damaging 0.74
R1980:Pde4dip UTSW 3 97,664,312 (GRCm39) missense possibly damaging 0.93
R2088:Pde4dip UTSW 3 97,661,749 (GRCm39) missense probably null 1.00
R2143:Pde4dip UTSW 3 97,795,835 (GRCm39) missense possibly damaging 0.86
R2149:Pde4dip UTSW 3 97,700,152 (GRCm39) missense possibly damaging 0.64
R2156:Pde4dip UTSW 3 97,631,534 (GRCm39) missense probably damaging 0.98
R2158:Pde4dip UTSW 3 97,664,937 (GRCm39) missense probably benign 0.15
R2240:Pde4dip UTSW 3 97,631,480 (GRCm39) missense probably benign 0.00
R2249:Pde4dip UTSW 3 97,700,841 (GRCm39) missense probably damaging 1.00
R2256:Pde4dip UTSW 3 97,625,500 (GRCm39) missense probably damaging 1.00
R2680:Pde4dip UTSW 3 97,608,933 (GRCm39) missense possibly damaging 0.92
R2921:Pde4dip UTSW 3 97,626,885 (GRCm39) missense probably benign
R3407:Pde4dip UTSW 3 97,661,784 (GRCm39) missense probably damaging 1.00
R3736:Pde4dip UTSW 3 97,631,427 (GRCm39) missense probably damaging 1.00
R3787:Pde4dip UTSW 3 97,622,868 (GRCm39) missense possibly damaging 0.80
R3883:Pde4dip UTSW 3 97,620,504 (GRCm39) missense probably damaging 1.00
R4437:Pde4dip UTSW 3 97,673,885 (GRCm39) missense possibly damaging 0.52
R4528:Pde4dip UTSW 3 97,624,338 (GRCm39) missense probably damaging 1.00
R4576:Pde4dip UTSW 3 97,661,565 (GRCm39) missense probably damaging 1.00
R4600:Pde4dip UTSW 3 97,603,260 (GRCm39) missense probably damaging 0.98
R4653:Pde4dip UTSW 3 97,674,654 (GRCm39) missense probably damaging 0.99
R4678:Pde4dip UTSW 3 97,602,321 (GRCm39) missense probably damaging 1.00
R4679:Pde4dip UTSW 3 97,602,321 (GRCm39) missense probably damaging 1.00
R4688:Pde4dip UTSW 3 97,750,993 (GRCm39) nonsense probably null
R4770:Pde4dip UTSW 3 97,674,400 (GRCm39) missense probably damaging 1.00
R4841:Pde4dip UTSW 3 97,700,844 (GRCm39) missense probably damaging 1.00
R4842:Pde4dip UTSW 3 97,700,844 (GRCm39) missense probably damaging 1.00
R4899:Pde4dip UTSW 3 97,616,874 (GRCm39) missense probably damaging 1.00
R4914:Pde4dip UTSW 3 97,622,644 (GRCm39) missense probably benign 0.10
R4943:Pde4dip UTSW 3 97,662,827 (GRCm39) missense probably damaging 0.99
R5131:Pde4dip UTSW 3 97,616,830 (GRCm39) missense probably damaging 0.98
R5408:Pde4dip UTSW 3 97,704,052 (GRCm39) missense probably benign 0.35
R5583:Pde4dip UTSW 3 97,654,892 (GRCm39) missense possibly damaging 0.67
R5677:Pde4dip UTSW 3 97,748,964 (GRCm39) nonsense probably null
R5689:Pde4dip UTSW 3 97,599,683 (GRCm39) nonsense probably null
R5696:Pde4dip UTSW 3 97,616,806 (GRCm39) missense probably damaging 1.00
R5860:Pde4dip UTSW 3 97,631,504 (GRCm39) missense possibly damaging 0.68
R6279:Pde4dip UTSW 3 97,606,496 (GRCm39) missense probably damaging 1.00
R6341:Pde4dip UTSW 3 97,602,227 (GRCm39) missense probably benign
R6440:Pde4dip UTSW 3 97,674,902 (GRCm39) missense probably damaging 1.00
R6464:Pde4dip UTSW 3 97,617,660 (GRCm39) missense probably damaging 1.00
R6489:Pde4dip UTSW 3 97,662,907 (GRCm39) nonsense probably null
R6706:Pde4dip UTSW 3 97,648,709 (GRCm39) missense probably damaging 1.00
R6722:Pde4dip UTSW 3 97,625,555 (GRCm39) nonsense probably null
R6798:Pde4dip UTSW 3 97,795,850 (GRCm39) missense probably benign
R6804:Pde4dip UTSW 3 97,700,564 (GRCm39) nonsense probably null
R6862:Pde4dip UTSW 3 97,674,340 (GRCm39) missense possibly damaging 0.52
R6957:Pde4dip UTSW 3 97,731,649 (GRCm39) splice site probably null
R6983:Pde4dip UTSW 3 97,625,552 (GRCm39) missense probably damaging 1.00
R7014:Pde4dip UTSW 3 97,622,738 (GRCm39) missense possibly damaging 0.54
R7025:Pde4dip UTSW 3 97,631,499 (GRCm39) nonsense probably null
R7136:Pde4dip UTSW 3 97,601,379 (GRCm39) missense probably benign 0.03
R7178:Pde4dip UTSW 3 97,622,946 (GRCm39) missense probably benign 0.26
R7269:Pde4dip UTSW 3 97,674,275 (GRCm39) missense probably damaging 1.00
R7283:Pde4dip UTSW 3 97,666,198 (GRCm39) missense probably benign 0.03
R7354:Pde4dip UTSW 3 97,626,646 (GRCm39) missense probably damaging 0.99
R7357:Pde4dip UTSW 3 97,622,857 (GRCm39) missense probably benign 0.01
R7360:Pde4dip UTSW 3 97,625,632 (GRCm39) missense probably benign 0.01
R7371:Pde4dip UTSW 3 97,664,587 (GRCm39) missense probably benign 0.08
R7432:Pde4dip UTSW 3 97,602,408 (GRCm39) missense probably benign
R7536:Pde4dip UTSW 3 97,664,560 (GRCm39) missense probably damaging 1.00
R7542:Pde4dip UTSW 3 97,673,971 (GRCm39) missense possibly damaging 0.59
R7609:Pde4dip UTSW 3 97,622,881 (GRCm39) missense possibly damaging 0.85
R7650:Pde4dip UTSW 3 97,606,423 (GRCm39) critical splice donor site probably null
R7800:Pde4dip UTSW 3 97,622,599 (GRCm39) missense probably damaging 1.00
R7846:Pde4dip UTSW 3 97,622,490 (GRCm39) missense probably damaging 1.00
R7918:Pde4dip UTSW 3 97,622,539 (GRCm39) nonsense probably null
R8120:Pde4dip UTSW 3 97,614,254 (GRCm39) missense probably null 0.94
R8139:Pde4dip UTSW 3 97,604,309 (GRCm39) missense probably benign 0.02
R8144:Pde4dip UTSW 3 97,622,742 (GRCm39) missense probably damaging 1.00
R8177:Pde4dip UTSW 3 97,674,848 (GRCm39) missense probably damaging 0.98
R8294:Pde4dip UTSW 3 97,674,694 (GRCm39) missense probably damaging 1.00
R8406:Pde4dip UTSW 3 97,606,428 (GRCm39) missense probably benign 0.04
R8911:Pde4dip UTSW 3 97,650,917 (GRCm39) missense probably benign 0.22
R8912:Pde4dip UTSW 3 97,617,633 (GRCm39) missense probably damaging 1.00
R8960:Pde4dip UTSW 3 97,700,464 (GRCm39) missense probably damaging 1.00
R8993:Pde4dip UTSW 3 97,673,810 (GRCm39) missense probably damaging 1.00
R9031:Pde4dip UTSW 3 97,599,675 (GRCm39) missense probably damaging 1.00
R9032:Pde4dip UTSW 3 97,601,385 (GRCm39) missense probably benign 0.00
R9085:Pde4dip UTSW 3 97,601,385 (GRCm39) missense probably benign 0.00
R9103:Pde4dip UTSW 3 97,749,044 (GRCm39) missense probably damaging 1.00
R9163:Pde4dip UTSW 3 97,659,123 (GRCm39) critical splice donor site probably null
R9182:Pde4dip UTSW 3 97,602,314 (GRCm39) missense probably benign 0.13
R9185:Pde4dip UTSW 3 97,666,132 (GRCm39) missense probably benign 0.01
R9286:Pde4dip UTSW 3 97,607,183 (GRCm39) missense probably damaging 1.00
R9357:Pde4dip UTSW 3 97,625,645 (GRCm39) missense probably benign 0.00
R9415:Pde4dip UTSW 3 97,660,468 (GRCm39) missense possibly damaging 0.82
R9500:Pde4dip UTSW 3 97,795,896 (GRCm39) missense unknown
R9595:Pde4dip UTSW 3 97,602,207 (GRCm39) critical splice donor site probably null
R9689:Pde4dip UTSW 3 97,649,841 (GRCm39) missense probably damaging 1.00
R9720:Pde4dip UTSW 3 97,603,287 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGCTTGGAGTTAAGCTGGTACATC -3'
(R):5'- GTGTCTCCTGCTCAGAAATGCAGAG -3'

Sequencing Primer
(F):5'- TGGTACATCGAGGAGCCTG -3'
(R):5'- CTGTGATGAACTGGGGTACTAACC -3'
Posted On 2014-05-14