Incidental Mutation 'R1700:Astn2'
ID189635
Institutional Source Beutler Lab
Gene Symbol Astn2
Ensembl Gene ENSMUSG00000028373
Gene Nameastrotactin 2
Synonyms1d8, Astnl
MMRRC Submission 039733-MU
Accession Numbers

Genbank: NM_019514.3, NM_207109.2; Ensembl: ENSMUST00000068214,   ENSMUST00000084496

Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R1700 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location65380803-66404611 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 65746354 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 679 (Q679*)
Ref Sequence ENSEMBL: ENSMUSP00000081540 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068214] [ENSMUST00000084496]
Predicted Effect probably null
Transcript: ENSMUST00000068214
AA Change: Q731*
SMART Domains Protein: ENSMUSP00000065786
Gene: ENSMUSG00000028373
AA Change: Q731*

DomainStartEndE-ValueType
signal peptide 1 51 N/A INTRINSIC
low complexity region 87 127 N/A INTRINSIC
transmembrane domain 219 241 N/A INTRINSIC
low complexity region 303 312 N/A INTRINSIC
low complexity region 342 361 N/A INTRINSIC
low complexity region 393 404 N/A INTRINSIC
low complexity region 432 437 N/A INTRINSIC
transmembrane domain 443 465 N/A INTRINSIC
EGF_like 526 563 2.92e1 SMART
Blast:EGF_like 667 708 2e-18 BLAST
EGF_like 715 764 4.03e1 SMART
MACPF 864 1048 2.88e-55 SMART
FN3 1079 1191 2.41e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000084496
AA Change: Q679*
SMART Domains Protein: ENSMUSP00000081540
Gene: ENSMUSG00000028373
AA Change: Q679*

DomainStartEndE-ValueType
signal peptide 1 51 N/A INTRINSIC
low complexity region 87 127 N/A INTRINSIC
transmembrane domain 219 241 N/A INTRINSIC
low complexity region 303 312 N/A INTRINSIC
low complexity region 341 352 N/A INTRINSIC
low complexity region 380 385 N/A INTRINSIC
transmembrane domain 391 413 N/A INTRINSIC
EGF_like 474 511 2.92e1 SMART
Blast:EGF_like 615 656 2e-18 BLAST
EGF_like 663 712 4.03e1 SMART
MACPF 812 996 2.88e-55 SMART
FN3 1027 1139 2.41e0 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is expressed in the brain and may function in neuronal migration, based on functional studies of the related astrotactin 1 gene in human and mouse. A deletion at this locus has been associated with schizophrenia. Multiple transcript variants encoding different proteins have been found for this locus. [provided by RefSeq, May 2010]
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik G A 2: 130,709,938 L1010F probably damaging Het
Abcb1b T C 5: 8,849,537 F936L probably benign Het
Adamts12 T A 15: 11,152,057 I211N probably benign Het
Adamts16 G A 13: 70,779,518 probably benign Het
Alas1 C T 9: 106,239,646 V293I possibly damaging Het
Ap1g1 T C 8: 109,853,612 Y569H probably damaging Het
Apc2 A G 10: 80,312,769 D1190G probably damaging Het
Atp2a1 T A 7: 126,462,909 H5L probably damaging Het
Baiap3 T C 17: 25,249,328 K279E probably damaging Het
C2cd2l G A 9: 44,316,612 P111S probably benign Het
C7 T A 15: 5,002,792 K646* probably null Het
Ccp110 C T 7: 118,735,313 T1003I probably damaging Het
Cdh22 T C 2: 165,170,796 D123G probably damaging Het
Cep295 C T 9: 15,340,883 E397K probably damaging Het
Clip1 A G 5: 123,630,370 V722A probably benign Het
Cpsf4l A G 11: 113,702,075 F174S probably benign Het
Ctnna3 T C 10: 63,852,772 C332R probably damaging Het
Cxcl10 A T 5: 92,347,855 N76K probably damaging Het
Dnaja3 G A 16: 4,684,165 R11K probably null Het
Efcab10 A G 12: 33,395,171 T28A possibly damaging Het
Esrrg A G 1: 188,043,653 R103G probably damaging Het
Exosc2 A G 2: 31,670,806 K23E probably benign Het
Flot2 C T 11: 78,049,547 S40L possibly damaging Het
Fsip2 T C 2: 82,991,737 V5938A probably benign Het
Gclc A G 9: 77,776,289 T143A probably benign Het
Gpr37 A G 6: 25,669,624 V407A probably benign Het
Gucy2e A T 11: 69,232,058 M497K probably benign Het
Herc1 T A 9: 66,450,678 probably null Het
Hnrnpll A C 17: 80,034,105 S502A probably benign Het
Ipo11 G T 13: 106,795,662 T975N probably benign Het
Kif17 C T 4: 138,262,698 Q66* probably null Het
Lrp10 T C 14: 54,469,752 V682A possibly damaging Het
Lsmem1 A T 12: 40,180,678 L75Q probably damaging Het
Med16 A T 10: 79,899,335 Y430N probably benign Het
Med8 C T 4: 118,412,734 S72L possibly damaging Het
Mex3a A G 3: 88,536,375 T253A probably damaging Het
Myf6 T C 10: 107,493,359 K242E probably damaging Het
Ncald T A 15: 37,397,343 Y31F probably benign Het
Ndufa12 T A 10: 94,199,993 Y48N probably damaging Het
Olfr1111 T G 2: 87,149,779 N294T probably damaging Het
Olfr1145 T C 2: 87,810,768 V316A probably benign Het
Olfr638 T A 7: 104,004,122 Y282* probably null Het
Pde4dip T C 3: 97,703,323 T1858A probably benign Het
Pgbd1 A G 13: 21,434,481 L2P probably damaging Het
Piezo1 C T 8: 122,487,502 R1642H probably damaging Het
Plxna1 A T 6: 89,357,008 M213K probably damaging Het
Polr1b A G 2: 129,123,121 N709S probably damaging Het
Pramel1 T A 4: 143,398,429 W308R probably damaging Het
Prkag2 A T 5: 24,871,541 I208N probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rngtt T A 4: 33,330,864 F156I probably damaging Het
Rpusd3 A G 6: 113,415,533 *345Q probably null Het
Rrp1b A G 17: 32,057,204 K575R probably benign Het
Shd G A 17: 55,974,307 V250I probably damaging Het
Slc12a5 C A 2: 164,992,376 N749K possibly damaging Het
Sorbs2 T A 8: 45,800,984 V488D probably damaging Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Srsf4 C A 4: 131,900,560 probably benign Het
Strn T C 17: 78,692,402 Y135C probably damaging Het
Synm T C 7: 67,759,628 M1V probably null Het
Tas1r3 T G 4: 155,861,570 Q489P probably benign Het
Tas2r103 A T 6: 133,036,811 N97K probably damaging Het
Tas2r113 A G 6: 132,893,792 Y261C possibly damaging Het
Tex21 T C 12: 76,221,672 E112G probably damaging Het
Trappc8 T C 18: 20,832,998 S1128G probably damaging Het
Ubap1l A G 9: 65,371,743 probably benign Het
Ubash3a A G 17: 31,215,044 D121G probably damaging Het
Ubxn4 A G 1: 128,252,286 I56V possibly damaging Het
Uri1 T C 7: 37,963,524 I348M probably damaging Het
Usp21 C A 1: 171,283,722 L379F probably damaging Het
Vmn1r159 T A 7: 22,842,965 H214L probably damaging Het
Zdbf2 A G 1: 63,302,741 E93G unknown Het
Other mutations in Astn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00964:Astn2 APN 4 66185187 missense unknown
IGL01657:Astn2 APN 4 65651949 missense probably damaging 0.99
IGL01747:Astn2 APN 4 65794618 missense probably benign 0.17
IGL02008:Astn2 APN 4 66059153 missense probably damaging 1.00
IGL02215:Astn2 APN 4 66266234 missense unknown
IGL02484:Astn2 APN 4 65992279 splice site probably benign
IGL02494:Astn2 APN 4 65992348 missense probably benign 0.23
IGL02792:Astn2 APN 4 65644821 missense probably benign 0.32
IGL03248:Astn2 APN 4 65746293 splice site probably benign
IGL03409:Astn2 APN 4 65435186 missense possibly damaging 0.46
B6584:Astn2 UTSW 4 65992387 missense probably damaging 0.99
R0015:Astn2 UTSW 4 66266382 critical splice acceptor site probably null
R0015:Astn2 UTSW 4 66266382 critical splice acceptor site probably null
R0092:Astn2 UTSW 4 66403982 missense unknown
R0245:Astn2 UTSW 4 65794558 missense probably damaging 0.99
R0528:Astn2 UTSW 4 65644882 splice site probably benign
R0586:Astn2 UTSW 4 66185142 missense unknown
R0652:Astn2 UTSW 4 65794558 missense probably damaging 0.99
R0880:Astn2 UTSW 4 65648330 missense probably damaging 0.99
R0931:Astn2 UTSW 4 65648293 missense probably damaging 0.99
R1353:Astn2 UTSW 4 66266335 missense unknown
R1934:Astn2 UTSW 4 65435189 missense probably damaging 0.99
R2017:Astn2 UTSW 4 65540941 missense probably damaging 0.99
R2101:Astn2 UTSW 4 65581686 nonsense probably null
R2158:Astn2 UTSW 4 66404254 missense unknown
R2907:Astn2 UTSW 4 65644856 missense possibly damaging 0.92
R2923:Astn2 UTSW 4 65913773 missense probably damaging 1.00
R2938:Astn2 UTSW 4 65992313 missense possibly damaging 0.92
R3033:Astn2 UTSW 4 65644706 missense probably damaging 1.00
R3933:Astn2 UTSW 4 66403955 missense unknown
R4151:Astn2 UTSW 4 65729320 critical splice donor site probably null
R4230:Astn2 UTSW 4 65911682 missense probably damaging 0.99
R4497:Astn2 UTSW 4 66119063 intron probably benign
R4717:Astn2 UTSW 4 65644754 missense possibly damaging 0.86
R4844:Astn2 UTSW 4 65644730 missense possibly damaging 0.90
R4928:Astn2 UTSW 4 65729407 missense probably damaging 0.98
R5374:Astn2 UTSW 4 65397005 missense probably damaging 0.96
R5442:Astn2 UTSW 4 65581786 missense possibly damaging 0.86
R5694:Astn2 UTSW 4 65950138 missense probably damaging 1.00
R5756:Astn2 UTSW 4 66119188 intron probably benign
R5763:Astn2 UTSW 4 65729331 missense probably benign 0.14
R6089:Astn2 UTSW 4 65794573 missense probably damaging 0.96
R6990:Astn2 UTSW 4 65992303 missense possibly damaging 0.82
R7304:Astn2 UTSW 4 66185375 missense unknown
R7325:Astn2 UTSW 4 65542669 missense probably benign 0.33
R7356:Astn2 UTSW 4 66185266 missense unknown
R7414:Astn2 UTSW 4 65540956 missense possibly damaging 0.85
R7755:Astn2 UTSW 4 65794558 missense probably damaging 0.99
R7887:Astn2 UTSW 4 65644866 missense possibly damaging 0.51
R7970:Astn2 UTSW 4 65644866 missense possibly damaging 0.51
R8027:Astn2 UTSW 4 65540971 missense possibly damaging 0.86
R8046:Astn2 UTSW 4 66266350 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCACACCGAATTGGGTATGAAGCA -3'
(R):5'- TTGACTTCTGGACCCCATCTGTGTA -3'

Sequencing Primer
(F):5'- AAGAAGCAAAAGGCCATATCCTTG -3'
(R):5'- TATAGGAAAGATGGAACCTGCCAC -3'
Posted On2014-05-14