Incidental Mutation 'R1700:Srsf4'
ID 189637
Institutional Source Beutler Lab
Gene Symbol Srsf4
Ensembl Gene ENSMUSG00000028911
Gene Name serine and arginine-rich splicing factor 4
Synonyms 5730499P16Rik, SRp75, MNCb-2616, Sfrs4
MMRRC Submission 039733-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.430) question?
Stock # R1700 (G1)
Quality Score 192
Status Not validated
Chromosome 4
Chromosomal Location 131600928-131629017 bp(+) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) C to A at 131627871 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053819] [ENSMUST00000134943]
AlphaFold no structure available at present
Predicted Effect noncoding transcript
Transcript: ENSMUST00000030743
SMART Domains Protein: ENSMUSP00000030743
Gene: ENSMUSG00000028911

DomainStartEndE-ValueType
RRM 14 73 1.09e0 SMART
low complexity region 76 102 N/A INTRINSIC
RRM 110 178 2e-14 SMART
low complexity region 184 277 N/A INTRINSIC
low complexity region 304 328 N/A INTRINSIC
low complexity region 329 408 N/A INTRINSIC
low complexity region 460 496 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000053819
AA Change: Q322K
SMART Domains Protein: ENSMUSP00000061474
Gene: ENSMUSG00000028911
AA Change: Q322K

DomainStartEndE-ValueType
RRM 3 68 4.3e-21 SMART
low complexity region 71 97 N/A INTRINSIC
RRM 105 173 8.4e-17 SMART
low complexity region 179 272 N/A INTRINSIC
low complexity region 299 323 N/A INTRINSIC
low complexity region 324 403 N/A INTRINSIC
low complexity region 455 490 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000121250
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124738
Predicted Effect probably benign
Transcript: ENSMUST00000134943
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the serine/arginine (SR)-rich family of pre-mRNA splicing factors, which constitute part of the spliceosome. Each of these factors contains an RNA recognition motif (RRM) for binding RNA and an RS domain for binding other proteins. The RS domain is rich in serine and arginine residues and facilitates interaction between different SR splicing factors. In addition to being critical for mRNA splicing, the SR proteins have also been shown to be involved in mRNA export from the nucleus and in translation. [provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T C 5: 8,899,537 (GRCm39) F936L probably benign Het
Adamts12 T A 15: 11,152,143 (GRCm39) I211N probably benign Het
Adamts16 G A 13: 70,927,637 (GRCm39) probably benign Het
Alas1 C T 9: 106,116,845 (GRCm39) V293I possibly damaging Het
Ap1g1 T C 8: 110,580,244 (GRCm39) Y569H probably damaging Het
Apc2 A G 10: 80,148,603 (GRCm39) D1190G probably damaging Het
Astn2 G A 4: 65,664,591 (GRCm39) Q679* probably null Het
Atp2a1 T A 7: 126,062,081 (GRCm39) H5L probably damaging Het
Baiap3 T C 17: 25,468,302 (GRCm39) K279E probably damaging Het
C2cd2l G A 9: 44,227,909 (GRCm39) P111S probably benign Het
C7 T A 15: 5,032,274 (GRCm39) K646* probably null Het
Ccp110 C T 7: 118,334,536 (GRCm39) T1003I probably damaging Het
Cdh22 T C 2: 165,012,716 (GRCm39) D123G probably damaging Het
Cep295 C T 9: 15,252,179 (GRCm39) E397K probably damaging Het
Clip1 A G 5: 123,768,433 (GRCm39) V722A probably benign Het
Cpsf4l A G 11: 113,592,901 (GRCm39) F174S probably benign Het
Ctnna3 T C 10: 63,688,551 (GRCm39) C332R probably damaging Het
Cxcl10 A T 5: 92,495,714 (GRCm39) N76K probably damaging Het
Dnaaf9 G A 2: 130,551,858 (GRCm39) L1010F probably damaging Het
Dnaja3 G A 16: 4,502,029 (GRCm39) R11K probably null Het
Efcab10 A G 12: 33,445,170 (GRCm39) T28A possibly damaging Het
Esrrg A G 1: 187,775,850 (GRCm39) R103G probably damaging Het
Exosc2 A G 2: 31,560,818 (GRCm39) K23E probably benign Het
Flot2 C T 11: 77,940,373 (GRCm39) S40L possibly damaging Het
Fsip2 T C 2: 82,822,081 (GRCm39) V5938A probably benign Het
Gclc A G 9: 77,683,571 (GRCm39) T143A probably benign Het
Gpr37 A G 6: 25,669,623 (GRCm39) V407A probably benign Het
Gucy2e A T 11: 69,122,884 (GRCm39) M497K probably benign Het
Herc1 T A 9: 66,357,960 (GRCm39) probably null Het
Hnrnpll A C 17: 80,341,534 (GRCm39) S502A probably benign Het
Ipo11 G T 13: 106,932,170 (GRCm39) T975N probably benign Het
Kif17 C T 4: 137,990,009 (GRCm39) Q66* probably null Het
Lrp10 T C 14: 54,707,209 (GRCm39) V682A possibly damaging Het
Lsmem1 A T 12: 40,230,677 (GRCm39) L75Q probably damaging Het
Med16 A T 10: 79,735,169 (GRCm39) Y430N probably benign Het
Med8 C T 4: 118,269,931 (GRCm39) S72L possibly damaging Het
Mex3a A G 3: 88,443,682 (GRCm39) T253A probably damaging Het
Myf6 T C 10: 107,329,220 (GRCm39) K242E probably damaging Het
Ncald T A 15: 37,397,587 (GRCm39) Y31F probably benign Het
Ndufa12 T A 10: 94,035,855 (GRCm39) Y48N probably damaging Het
Or12e10 T C 2: 87,641,112 (GRCm39) V316A probably benign Het
Or51q1c T A 7: 103,653,329 (GRCm39) Y282* probably null Het
Or5as1 T G 2: 86,980,123 (GRCm39) N294T probably damaging Het
Pde4dip T C 3: 97,610,639 (GRCm39) T1858A probably benign Het
Pgbd1 A G 13: 21,618,651 (GRCm39) L2P probably damaging Het
Piezo1 C T 8: 123,214,241 (GRCm39) R1642H probably damaging Het
Plxna1 A T 6: 89,333,990 (GRCm39) M213K probably damaging Het
Polr1b A G 2: 128,965,041 (GRCm39) N709S probably damaging Het
Pramel1 T A 4: 143,124,999 (GRCm39) W308R probably damaging Het
Prkag2 A T 5: 25,076,539 (GRCm39) I208N probably damaging Het
Ptpro T A 6: 137,420,592 (GRCm39) V1007D probably damaging Het
Rngtt T A 4: 33,330,864 (GRCm39) F156I probably damaging Het
Rpusd3 A G 6: 113,392,494 (GRCm39) *345Q probably null Het
Rrp1b A G 17: 32,276,178 (GRCm39) K575R probably benign Het
Shd G A 17: 56,281,307 (GRCm39) V250I probably damaging Het
Slc12a5 C A 2: 164,834,296 (GRCm39) N749K possibly damaging Het
Sorbs2 T A 8: 46,254,021 (GRCm39) V488D probably damaging Het
Sphkap G A 1: 83,255,236 (GRCm39) R838* probably null Het
Strn T C 17: 78,999,831 (GRCm39) Y135C probably damaging Het
Synm T C 7: 67,409,376 (GRCm39) M1V probably null Het
Tas1r3 T G 4: 155,946,027 (GRCm39) Q489P probably benign Het
Tas2r103 A T 6: 133,013,774 (GRCm39) N97K probably damaging Het
Tas2r113 A G 6: 132,870,755 (GRCm39) Y261C possibly damaging Het
Tex21 T C 12: 76,268,446 (GRCm39) E112G probably damaging Het
Trappc8 T C 18: 20,966,055 (GRCm39) S1128G probably damaging Het
Ubap1l A G 9: 65,279,025 (GRCm39) probably benign Het
Ubash3a A G 17: 31,434,018 (GRCm39) D121G probably damaging Het
Ubxn4 A G 1: 128,180,023 (GRCm39) I56V possibly damaging Het
Uri1 T C 7: 37,662,949 (GRCm39) I348M probably damaging Het
Usp21 C A 1: 171,111,295 (GRCm39) L379F probably damaging Het
Vmn1r159 T A 7: 22,542,390 (GRCm39) H214L probably damaging Het
Zdbf2 A G 1: 63,341,900 (GRCm39) E93G unknown Het
Other mutations in Srsf4
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0087:Srsf4 UTSW 4 131,627,641 (GRCm39) unclassified probably benign
R1135:Srsf4 UTSW 4 131,627,380 (GRCm39) unclassified probably benign
R1209:Srsf4 UTSW 4 131,628,370 (GRCm39) unclassified probably benign
R1276:Srsf4 UTSW 4 131,624,996 (GRCm39) missense probably damaging 1.00
R1561:Srsf4 UTSW 4 131,625,006 (GRCm39) missense probably damaging 1.00
R1574:Srsf4 UTSW 4 131,625,006 (GRCm39) missense probably damaging 1.00
R2265:Srsf4 UTSW 4 131,624,993 (GRCm39) missense probably damaging 1.00
R2269:Srsf4 UTSW 4 131,624,993 (GRCm39) missense probably damaging 1.00
R3723:Srsf4 UTSW 4 131,627,413 (GRCm39) unclassified probably benign
R3724:Srsf4 UTSW 4 131,627,413 (GRCm39) unclassified probably benign
R3737:Srsf4 UTSW 4 131,627,413 (GRCm39) unclassified probably benign
R3738:Srsf4 UTSW 4 131,627,413 (GRCm39) unclassified probably benign
R3739:Srsf4 UTSW 4 131,627,413 (GRCm39) unclassified probably benign
R4034:Srsf4 UTSW 4 131,627,413 (GRCm39) unclassified probably benign
R4035:Srsf4 UTSW 4 131,627,413 (GRCm39) unclassified probably benign
R4049:Srsf4 UTSW 4 131,627,854 (GRCm39) unclassified probably benign
R4535:Srsf4 UTSW 4 131,601,175 (GRCm39) missense probably damaging 1.00
R4810:Srsf4 UTSW 4 131,627,413 (GRCm39) unclassified probably benign
R4833:Srsf4 UTSW 4 131,627,413 (GRCm39) unclassified probably benign
R4932:Srsf4 UTSW 4 131,618,556 (GRCm39) missense probably damaging 0.99
R5291:Srsf4 UTSW 4 131,613,617 (GRCm39) critical splice donor site probably benign
R5725:Srsf4 UTSW 4 131,628,262 (GRCm39) unclassified probably benign
R6145:Srsf4 UTSW 4 131,627,605 (GRCm39) unclassified probably benign
R7056:Srsf4 UTSW 4 131,628,004 (GRCm39) unclassified probably benign
R7294:Srsf4 UTSW 4 131,627,772 (GRCm39) missense unknown
R7964:Srsf4 UTSW 4 131,618,544 (GRCm39) missense probably benign 0.09
R8697:Srsf4 UTSW 4 131,628,042 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- TGGTAGCAGTAAAAGCAGCCATTCG -3'
(R):5'- AGACTCTGCCTTGGCATGTTCG -3'

Sequencing Primer
(F):5'- TCTCCAGTTCCTGACAGAAAGTG -3'
(R):5'- tgctgctgctgctactg -3'
Posted On 2014-05-14