Incidental Mutation 'R1700:Srsf4'
ID189637
Institutional Source Beutler Lab
Gene Symbol Srsf4
Ensembl Gene ENSMUSG00000028911
Gene Nameserine/arginine-rich splicing factor 4
SynonymsMNCb-2616, Sfrs4, SRp75, 5730499P16Rik
MMRRC Submission 039733-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.351) question?
Stock #R1700 (G1)
Quality Score192
Status Not validated
Chromosome4
Chromosomal Location131873617-131901706 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to A at 131900560 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053819] [ENSMUST00000134943]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000030743
SMART Domains Protein: ENSMUSP00000030743
Gene: ENSMUSG00000028911

DomainStartEndE-ValueType
RRM 14 73 1.09e0 SMART
low complexity region 76 102 N/A INTRINSIC
RRM 110 178 2e-14 SMART
low complexity region 184 277 N/A INTRINSIC
low complexity region 304 328 N/A INTRINSIC
low complexity region 329 408 N/A INTRINSIC
low complexity region 460 496 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000053819
AA Change: Q322K
SMART Domains Protein: ENSMUSP00000061474
Gene: ENSMUSG00000028911
AA Change: Q322K

DomainStartEndE-ValueType
RRM 3 68 4.3e-21 SMART
low complexity region 71 97 N/A INTRINSIC
RRM 105 173 8.4e-17 SMART
low complexity region 179 272 N/A INTRINSIC
low complexity region 299 323 N/A INTRINSIC
low complexity region 324 403 N/A INTRINSIC
low complexity region 455 490 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000121250
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124738
Predicted Effect probably benign
Transcript: ENSMUST00000134943
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the serine/arginine (SR)-rich family of pre-mRNA splicing factors, which constitute part of the spliceosome. Each of these factors contains an RNA recognition motif (RRM) for binding RNA and an RS domain for binding other proteins. The RS domain is rich in serine and arginine residues and facilitates interaction between different SR splicing factors. In addition to being critical for mRNA splicing, the SR proteins have also been shown to be involved in mRNA export from the nucleus and in translation. [provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik G A 2: 130,709,938 L1010F probably damaging Het
Abcb1b T C 5: 8,849,537 F936L probably benign Het
Adamts12 T A 15: 11,152,057 I211N probably benign Het
Adamts16 G A 13: 70,779,518 probably benign Het
Alas1 C T 9: 106,239,646 V293I possibly damaging Het
Ap1g1 T C 8: 109,853,612 Y569H probably damaging Het
Apc2 A G 10: 80,312,769 D1190G probably damaging Het
Astn2 G A 4: 65,746,354 Q679* probably null Het
Atp2a1 T A 7: 126,462,909 H5L probably damaging Het
Baiap3 T C 17: 25,249,328 K279E probably damaging Het
C2cd2l G A 9: 44,316,612 P111S probably benign Het
C7 T A 15: 5,002,792 K646* probably null Het
Ccp110 C T 7: 118,735,313 T1003I probably damaging Het
Cdh22 T C 2: 165,170,796 D123G probably damaging Het
Cep295 C T 9: 15,340,883 E397K probably damaging Het
Clip1 A G 5: 123,630,370 V722A probably benign Het
Cpsf4l A G 11: 113,702,075 F174S probably benign Het
Ctnna3 T C 10: 63,852,772 C332R probably damaging Het
Cxcl10 A T 5: 92,347,855 N76K probably damaging Het
Dnaja3 G A 16: 4,684,165 R11K probably null Het
Efcab10 A G 12: 33,395,171 T28A possibly damaging Het
Esrrg A G 1: 188,043,653 R103G probably damaging Het
Exosc2 A G 2: 31,670,806 K23E probably benign Het
Flot2 C T 11: 78,049,547 S40L possibly damaging Het
Fsip2 T C 2: 82,991,737 V5938A probably benign Het
Gclc A G 9: 77,776,289 T143A probably benign Het
Gpr37 A G 6: 25,669,624 V407A probably benign Het
Gucy2e A T 11: 69,232,058 M497K probably benign Het
Herc1 T A 9: 66,450,678 probably null Het
Hnrnpll A C 17: 80,034,105 S502A probably benign Het
Ipo11 G T 13: 106,795,662 T975N probably benign Het
Kif17 C T 4: 138,262,698 Q66* probably null Het
Lrp10 T C 14: 54,469,752 V682A possibly damaging Het
Lsmem1 A T 12: 40,180,678 L75Q probably damaging Het
Med16 A T 10: 79,899,335 Y430N probably benign Het
Med8 C T 4: 118,412,734 S72L possibly damaging Het
Mex3a A G 3: 88,536,375 T253A probably damaging Het
Myf6 T C 10: 107,493,359 K242E probably damaging Het
Ncald T A 15: 37,397,343 Y31F probably benign Het
Ndufa12 T A 10: 94,199,993 Y48N probably damaging Het
Olfr1111 T G 2: 87,149,779 N294T probably damaging Het
Olfr1145 T C 2: 87,810,768 V316A probably benign Het
Olfr638 T A 7: 104,004,122 Y282* probably null Het
Pde4dip T C 3: 97,703,323 T1858A probably benign Het
Pgbd1 A G 13: 21,434,481 L2P probably damaging Het
Piezo1 C T 8: 122,487,502 R1642H probably damaging Het
Plxna1 A T 6: 89,357,008 M213K probably damaging Het
Polr1b A G 2: 129,123,121 N709S probably damaging Het
Pramel1 T A 4: 143,398,429 W308R probably damaging Het
Prkag2 A T 5: 24,871,541 I208N probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rngtt T A 4: 33,330,864 F156I probably damaging Het
Rpusd3 A G 6: 113,415,533 *345Q probably null Het
Rrp1b A G 17: 32,057,204 K575R probably benign Het
Shd G A 17: 55,974,307 V250I probably damaging Het
Slc12a5 C A 2: 164,992,376 N749K possibly damaging Het
Sorbs2 T A 8: 45,800,984 V488D probably damaging Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Strn T C 17: 78,692,402 Y135C probably damaging Het
Synm T C 7: 67,759,628 M1V probably null Het
Tas1r3 T G 4: 155,861,570 Q489P probably benign Het
Tas2r103 A T 6: 133,036,811 N97K probably damaging Het
Tas2r113 A G 6: 132,893,792 Y261C possibly damaging Het
Tex21 T C 12: 76,221,672 E112G probably damaging Het
Trappc8 T C 18: 20,832,998 S1128G probably damaging Het
Ubap1l A G 9: 65,371,743 probably benign Het
Ubash3a A G 17: 31,215,044 D121G probably damaging Het
Ubxn4 A G 1: 128,252,286 I56V possibly damaging Het
Uri1 T C 7: 37,963,524 I348M probably damaging Het
Usp21 C A 1: 171,283,722 L379F probably damaging Het
Vmn1r159 T A 7: 22,842,965 H214L probably damaging Het
Zdbf2 A G 1: 63,302,741 E93G unknown Het
Other mutations in Srsf4
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0087:Srsf4 UTSW 4 131900330 unclassified probably benign
R1135:Srsf4 UTSW 4 131900069 unclassified probably benign
R1209:Srsf4 UTSW 4 131901059 unclassified probably benign
R1276:Srsf4 UTSW 4 131897685 missense probably damaging 1.00
R1561:Srsf4 UTSW 4 131897695 missense probably damaging 1.00
R1574:Srsf4 UTSW 4 131897695 missense probably damaging 1.00
R2265:Srsf4 UTSW 4 131897682 missense probably damaging 1.00
R2269:Srsf4 UTSW 4 131897682 missense probably damaging 1.00
R3723:Srsf4 UTSW 4 131900102 unclassified probably benign
R3724:Srsf4 UTSW 4 131900102 unclassified probably benign
R3737:Srsf4 UTSW 4 131900102 unclassified probably benign
R3738:Srsf4 UTSW 4 131900102 unclassified probably benign
R3739:Srsf4 UTSW 4 131900102 unclassified probably benign
R4034:Srsf4 UTSW 4 131900102 unclassified probably benign
R4035:Srsf4 UTSW 4 131900102 unclassified probably benign
R4049:Srsf4 UTSW 4 131900543 unclassified probably benign
R4535:Srsf4 UTSW 4 131873864 missense probably damaging 1.00
R4810:Srsf4 UTSW 4 131900102 unclassified probably benign
R4833:Srsf4 UTSW 4 131900102 unclassified probably benign
R4932:Srsf4 UTSW 4 131891245 missense probably damaging 0.99
R5291:Srsf4 UTSW 4 131886306 critical splice donor site probably benign
R5725:Srsf4 UTSW 4 131900951 unclassified probably benign
R6145:Srsf4 UTSW 4 131900294 unclassified probably benign
R7056:Srsf4 UTSW 4 131900693 unclassified probably benign
R7294:Srsf4 UTSW 4 131900461 missense unknown
Predicted Primers PCR Primer
(F):5'- TGGTAGCAGTAAAAGCAGCCATTCG -3'
(R):5'- AGACTCTGCCTTGGCATGTTCG -3'

Sequencing Primer
(F):5'- TCTCCAGTTCCTGACAGAAAGTG -3'
(R):5'- tgctgctgctgctactg -3'
Posted On2014-05-14