Incidental Mutation 'R1700:Tas1r3'
ID 189640
Institutional Source Beutler Lab
Gene Symbol Tas1r3
Ensembl Gene ENSMUSG00000029072
Gene Name taste receptor, type 1, member 3
Synonyms T1r3
MMRRC Submission 039733-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.108) question?
Stock # R1700 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 155943725-155947810 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 155946027 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Proline at position 489 (Q489P)
Ref Sequence ENSEMBL: ENSMUSP00000030949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030948] [ENSMUST00000030949] [ENSMUST00000030950] [ENSMUST00000151961] [ENSMUST00000168552]
AlphaFold Q925D8
Predicted Effect probably benign
Transcript: ENSMUST00000030948
SMART Domains Protein: ENSMUSP00000030948
Gene: ENSMUSG00000029071

DomainStartEndE-ValueType
DAX 1 85 2.17e-52 SMART
Pfam:Dishevelled 144 215 1.1e-31 PFAM
low complexity region 217 233 N/A INTRINSIC
low complexity region 235 246 N/A INTRINSIC
PDZ 260 339 3.13e-16 SMART
low complexity region 380 397 N/A INTRINSIC
DEP 425 499 1.47e-26 SMART
Pfam:Dsh_C 503 685 4.2e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000030949
AA Change: Q489P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000030949
Gene: ENSMUSG00000029072
AA Change: Q489P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 72 469 2e-79 PFAM
Pfam:NCD3G 500 552 1.9e-16 PFAM
Pfam:7tm_3 576 821 9.6e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000030950
SMART Domains Protein: ENSMUSP00000030950
Gene: ENSMUSG00000029073

DomainStartEndE-ValueType
Pfam:GLTP 27 179 1.4e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133184
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141539
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143457
Predicted Effect probably benign
Transcript: ENSMUST00000151961
SMART Domains Protein: ENSMUSP00000115935
Gene: ENSMUSG00000029073

DomainStartEndE-ValueType
Pfam:GLTP 25 181 1.9e-49 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156266
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156997
Predicted Effect probably benign
Transcript: ENSMUST00000168552
SMART Domains Protein: ENSMUSP00000133137
Gene: ENSMUSG00000029071

DomainStartEndE-ValueType
DAX 1 85 2.17e-52 SMART
Pfam:Dishevelled 90 247 1.7e-60 PFAM
PDZ 260 339 3.13e-16 SMART
low complexity region 380 397 N/A INTRINSIC
DEP 425 499 1.47e-26 SMART
Pfam:Dsh_C 503 685 7.6e-59 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a G-protein coupled receptor involved in taste responses. The encoded protein can form a heterodimeric receptor with TAS1R1 to elicit the umami taste response, or it can bind with TAS1R2 to form a receptor for the sweet taste response. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mutation of this locus affects taste perception. Complete inactivation results in diminished behavioral and nervous repsonses to both sweet and umami tastants. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T C 5: 8,899,537 (GRCm39) F936L probably benign Het
Adamts12 T A 15: 11,152,143 (GRCm39) I211N probably benign Het
Adamts16 G A 13: 70,927,637 (GRCm39) probably benign Het
Alas1 C T 9: 106,116,845 (GRCm39) V293I possibly damaging Het
Ap1g1 T C 8: 110,580,244 (GRCm39) Y569H probably damaging Het
Apc2 A G 10: 80,148,603 (GRCm39) D1190G probably damaging Het
Astn2 G A 4: 65,664,591 (GRCm39) Q679* probably null Het
Atp2a1 T A 7: 126,062,081 (GRCm39) H5L probably damaging Het
Baiap3 T C 17: 25,468,302 (GRCm39) K279E probably damaging Het
C2cd2l G A 9: 44,227,909 (GRCm39) P111S probably benign Het
C7 T A 15: 5,032,274 (GRCm39) K646* probably null Het
Ccp110 C T 7: 118,334,536 (GRCm39) T1003I probably damaging Het
Cdh22 T C 2: 165,012,716 (GRCm39) D123G probably damaging Het
Cep295 C T 9: 15,252,179 (GRCm39) E397K probably damaging Het
Clip1 A G 5: 123,768,433 (GRCm39) V722A probably benign Het
Cpsf4l A G 11: 113,592,901 (GRCm39) F174S probably benign Het
Ctnna3 T C 10: 63,688,551 (GRCm39) C332R probably damaging Het
Cxcl10 A T 5: 92,495,714 (GRCm39) N76K probably damaging Het
Dnaaf9 G A 2: 130,551,858 (GRCm39) L1010F probably damaging Het
Dnaja3 G A 16: 4,502,029 (GRCm39) R11K probably null Het
Efcab10 A G 12: 33,445,170 (GRCm39) T28A possibly damaging Het
Esrrg A G 1: 187,775,850 (GRCm39) R103G probably damaging Het
Exosc2 A G 2: 31,560,818 (GRCm39) K23E probably benign Het
Flot2 C T 11: 77,940,373 (GRCm39) S40L possibly damaging Het
Fsip2 T C 2: 82,822,081 (GRCm39) V5938A probably benign Het
Gclc A G 9: 77,683,571 (GRCm39) T143A probably benign Het
Gpr37 A G 6: 25,669,623 (GRCm39) V407A probably benign Het
Gucy2e A T 11: 69,122,884 (GRCm39) M497K probably benign Het
Herc1 T A 9: 66,357,960 (GRCm39) probably null Het
Hnrnpll A C 17: 80,341,534 (GRCm39) S502A probably benign Het
Ipo11 G T 13: 106,932,170 (GRCm39) T975N probably benign Het
Kif17 C T 4: 137,990,009 (GRCm39) Q66* probably null Het
Lrp10 T C 14: 54,707,209 (GRCm39) V682A possibly damaging Het
Lsmem1 A T 12: 40,230,677 (GRCm39) L75Q probably damaging Het
Med16 A T 10: 79,735,169 (GRCm39) Y430N probably benign Het
Med8 C T 4: 118,269,931 (GRCm39) S72L possibly damaging Het
Mex3a A G 3: 88,443,682 (GRCm39) T253A probably damaging Het
Myf6 T C 10: 107,329,220 (GRCm39) K242E probably damaging Het
Ncald T A 15: 37,397,587 (GRCm39) Y31F probably benign Het
Ndufa12 T A 10: 94,035,855 (GRCm39) Y48N probably damaging Het
Or12e10 T C 2: 87,641,112 (GRCm39) V316A probably benign Het
Or51q1c T A 7: 103,653,329 (GRCm39) Y282* probably null Het
Or5as1 T G 2: 86,980,123 (GRCm39) N294T probably damaging Het
Pde4dip T C 3: 97,610,639 (GRCm39) T1858A probably benign Het
Pgbd1 A G 13: 21,618,651 (GRCm39) L2P probably damaging Het
Piezo1 C T 8: 123,214,241 (GRCm39) R1642H probably damaging Het
Plxna1 A T 6: 89,333,990 (GRCm39) M213K probably damaging Het
Polr1b A G 2: 128,965,041 (GRCm39) N709S probably damaging Het
Pramel1 T A 4: 143,124,999 (GRCm39) W308R probably damaging Het
Prkag2 A T 5: 25,076,539 (GRCm39) I208N probably damaging Het
Ptpro T A 6: 137,420,592 (GRCm39) V1007D probably damaging Het
Rngtt T A 4: 33,330,864 (GRCm39) F156I probably damaging Het
Rpusd3 A G 6: 113,392,494 (GRCm39) *345Q probably null Het
Rrp1b A G 17: 32,276,178 (GRCm39) K575R probably benign Het
Shd G A 17: 56,281,307 (GRCm39) V250I probably damaging Het
Slc12a5 C A 2: 164,834,296 (GRCm39) N749K possibly damaging Het
Sorbs2 T A 8: 46,254,021 (GRCm39) V488D probably damaging Het
Sphkap G A 1: 83,255,236 (GRCm39) R838* probably null Het
Srsf4 C A 4: 131,627,871 (GRCm39) probably benign Het
Strn T C 17: 78,999,831 (GRCm39) Y135C probably damaging Het
Synm T C 7: 67,409,376 (GRCm39) M1V probably null Het
Tas2r103 A T 6: 133,013,774 (GRCm39) N97K probably damaging Het
Tas2r113 A G 6: 132,870,755 (GRCm39) Y261C possibly damaging Het
Tex21 T C 12: 76,268,446 (GRCm39) E112G probably damaging Het
Trappc8 T C 18: 20,966,055 (GRCm39) S1128G probably damaging Het
Ubap1l A G 9: 65,279,025 (GRCm39) probably benign Het
Ubash3a A G 17: 31,434,018 (GRCm39) D121G probably damaging Het
Ubxn4 A G 1: 128,180,023 (GRCm39) I56V possibly damaging Het
Uri1 T C 7: 37,662,949 (GRCm39) I348M probably damaging Het
Usp21 C A 1: 171,111,295 (GRCm39) L379F probably damaging Het
Vmn1r159 T A 7: 22,542,390 (GRCm39) H214L probably damaging Het
Zdbf2 A G 1: 63,341,900 (GRCm39) E93G unknown Het
Other mutations in Tas1r3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01356:Tas1r3 APN 4 155,945,784 (GRCm39) missense probably benign 0.43
IGL01587:Tas1r3 APN 4 155,945,816 (GRCm39) missense probably damaging 0.99
IGL02314:Tas1r3 APN 4 155,945,119 (GRCm39) missense probably damaging 1.00
IGL02747:Tas1r3 APN 4 155,944,917 (GRCm39) missense possibly damaging 0.92
IGL02999:Tas1r3 APN 4 155,946,816 (GRCm39) missense probably damaging 0.97
IGL03026:Tas1r3 APN 4 155,946,300 (GRCm39) unclassified probably benign
IGL03407:Tas1r3 APN 4 155,946,439 (GRCm39) splice site probably null
R0122:Tas1r3 UTSW 4 155,945,290 (GRCm39) missense probably benign
R0827:Tas1r3 UTSW 4 155,945,326 (GRCm39) missense probably benign 0.02
R1803:Tas1r3 UTSW 4 155,944,927 (GRCm39) missense probably damaging 0.99
R1804:Tas1r3 UTSW 4 155,944,927 (GRCm39) missense probably damaging 0.99
R1883:Tas1r3 UTSW 4 155,946,610 (GRCm39) missense probably damaging 1.00
R1998:Tas1r3 UTSW 4 155,947,377 (GRCm39) missense probably damaging 1.00
R2061:Tas1r3 UTSW 4 155,944,927 (GRCm39) missense probably damaging 0.99
R2104:Tas1r3 UTSW 4 155,946,588 (GRCm39) missense probably benign 0.26
R2127:Tas1r3 UTSW 4 155,944,927 (GRCm39) missense probably damaging 0.99
R2129:Tas1r3 UTSW 4 155,944,927 (GRCm39) missense probably damaging 0.99
R2237:Tas1r3 UTSW 4 155,946,675 (GRCm39) missense possibly damaging 0.58
R2316:Tas1r3 UTSW 4 155,947,772 (GRCm39) missense probably benign
R2847:Tas1r3 UTSW 4 155,944,659 (GRCm39) missense probably benign 0.08
R3619:Tas1r3 UTSW 4 155,945,410 (GRCm39) missense probably damaging 0.99
R3870:Tas1r3 UTSW 4 155,945,810 (GRCm39) missense probably damaging 1.00
R4194:Tas1r3 UTSW 4 155,947,442 (GRCm39) missense probably damaging 1.00
R4195:Tas1r3 UTSW 4 155,947,442 (GRCm39) missense probably damaging 1.00
R4420:Tas1r3 UTSW 4 155,946,789 (GRCm39) missense probably damaging 0.99
R5577:Tas1r3 UTSW 4 155,946,522 (GRCm39) missense probably benign 0.36
R6734:Tas1r3 UTSW 4 155,945,257 (GRCm39) missense probably damaging 1.00
R7006:Tas1r3 UTSW 4 155,947,361 (GRCm39) missense possibly damaging 0.93
R7231:Tas1r3 UTSW 4 155,947,283 (GRCm39) missense probably damaging 1.00
R7490:Tas1r3 UTSW 4 155,946,480 (GRCm39) missense probably damaging 0.97
R7895:Tas1r3 UTSW 4 155,947,005 (GRCm39) missense probably damaging 1.00
R8701:Tas1r3 UTSW 4 155,945,503 (GRCm39) missense probably benign 0.00
R8796:Tas1r3 UTSW 4 155,945,848 (GRCm39) missense probably benign 0.15
R8941:Tas1r3 UTSW 4 155,947,600 (GRCm39) critical splice donor site probably null
R9371:Tas1r3 UTSW 4 155,945,059 (GRCm39) missense possibly damaging 0.75
R9576:Tas1r3 UTSW 4 155,946,822 (GRCm39) missense probably benign
R9743:Tas1r3 UTSW 4 155,945,256 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAAAGCCCTTTACTCGGCGAAC -3'
(R):5'- CCAGGCAGAGCCAAATCTTGTTGTG -3'

Sequencing Primer
(F):5'- TTTACTCGGCGAACCTGGC -3'
(R):5'- CCAAATCTTGTTGTGACTGGAGAG -3'
Posted On 2014-05-14