Incidental Mutation 'R1700:Olfr638'
ID 189656
Institutional Source Beutler Lab
Gene Symbol Olfr638
Ensembl Gene ENSMUSG00000094063
Gene Name olfactory receptor 638
Synonyms MOR5-1, GA_x6K02T2PBJ9-6737723-6738670
MMRRC Submission 039733-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.207) question?
Stock # R1700 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 103998746-104004357 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 104004122 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 282 (Y282*)
Ref Sequence ENSEMBL: ENSMUSP00000151996 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000138055] [ENSMUST00000209757] [ENSMUST00000215653] [ENSMUST00000218325]
AlphaFold Q8VH20
Predicted Effect probably null
Transcript: ENSMUST00000098184
AA Change: Y288*
SMART Domains Protein: ENSMUSP00000095786
Gene: ENSMUSG00000094063
AA Change: Y288*

DomainStartEndE-ValueType
Pfam:7tm_4 39 318 2.6e-119 PFAM
Pfam:7TM_GPCR_Srsx 43 198 9.8e-10 PFAM
Pfam:7tm_1 49 300 7.8e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138055
SMART Domains Protein: ENSMUSP00000139240
Gene: ENSMUSG00000109824

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000209757
AA Change: Y288*
Predicted Effect probably benign
Transcript: ENSMUST00000215653
Predicted Effect probably null
Transcript: ENSMUST00000218325
AA Change: Y282*
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik G A 2: 130,709,938 L1010F probably damaging Het
Abcb1b T C 5: 8,849,537 F936L probably benign Het
Adamts12 T A 15: 11,152,057 I211N probably benign Het
Adamts16 G A 13: 70,779,518 probably benign Het
Alas1 C T 9: 106,239,646 V293I possibly damaging Het
Ap1g1 T C 8: 109,853,612 Y569H probably damaging Het
Apc2 A G 10: 80,312,769 D1190G probably damaging Het
Astn2 G A 4: 65,746,354 Q679* probably null Het
Atp2a1 T A 7: 126,462,909 H5L probably damaging Het
Baiap3 T C 17: 25,249,328 K279E probably damaging Het
C2cd2l G A 9: 44,316,612 P111S probably benign Het
C7 T A 15: 5,002,792 K646* probably null Het
Ccp110 C T 7: 118,735,313 T1003I probably damaging Het
Cdh22 T C 2: 165,170,796 D123G probably damaging Het
Cep295 C T 9: 15,340,883 E397K probably damaging Het
Clip1 A G 5: 123,630,370 V722A probably benign Het
Cpsf4l A G 11: 113,702,075 F174S probably benign Het
Ctnna3 T C 10: 63,852,772 C332R probably damaging Het
Cxcl10 A T 5: 92,347,855 N76K probably damaging Het
Dnaja3 G A 16: 4,684,165 R11K probably null Het
Efcab10 A G 12: 33,395,171 T28A possibly damaging Het
Esrrg A G 1: 188,043,653 R103G probably damaging Het
Exosc2 A G 2: 31,670,806 K23E probably benign Het
Flot2 C T 11: 78,049,547 S40L possibly damaging Het
Fsip2 T C 2: 82,991,737 V5938A probably benign Het
Gclc A G 9: 77,776,289 T143A probably benign Het
Gpr37 A G 6: 25,669,624 V407A probably benign Het
Gucy2e A T 11: 69,232,058 M497K probably benign Het
Herc1 T A 9: 66,450,678 probably null Het
Hnrnpll A C 17: 80,034,105 S502A probably benign Het
Ipo11 G T 13: 106,795,662 T975N probably benign Het
Kif17 C T 4: 138,262,698 Q66* probably null Het
Lrp10 T C 14: 54,469,752 V682A possibly damaging Het
Lsmem1 A T 12: 40,180,678 L75Q probably damaging Het
Med16 A T 10: 79,899,335 Y430N probably benign Het
Med8 C T 4: 118,412,734 S72L possibly damaging Het
Mex3a A G 3: 88,536,375 T253A probably damaging Het
Myf6 T C 10: 107,493,359 K242E probably damaging Het
Ncald T A 15: 37,397,343 Y31F probably benign Het
Ndufa12 T A 10: 94,199,993 Y48N probably damaging Het
Olfr1111 T G 2: 87,149,779 N294T probably damaging Het
Olfr1145 T C 2: 87,810,768 V316A probably benign Het
Pde4dip T C 3: 97,703,323 T1858A probably benign Het
Pgbd1 A G 13: 21,434,481 L2P probably damaging Het
Piezo1 C T 8: 122,487,502 R1642H probably damaging Het
Plxna1 A T 6: 89,357,008 M213K probably damaging Het
Polr1b A G 2: 129,123,121 N709S probably damaging Het
Pramel1 T A 4: 143,398,429 W308R probably damaging Het
Prkag2 A T 5: 24,871,541 I208N probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rngtt T A 4: 33,330,864 F156I probably damaging Het
Rpusd3 A G 6: 113,415,533 *345Q probably null Het
Rrp1b A G 17: 32,057,204 K575R probably benign Het
Shd G A 17: 55,974,307 V250I probably damaging Het
Slc12a5 C A 2: 164,992,376 N749K possibly damaging Het
Sorbs2 T A 8: 45,800,984 V488D probably damaging Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Srsf4 C A 4: 131,900,560 probably benign Het
Strn T C 17: 78,692,402 Y135C probably damaging Het
Synm T C 7: 67,759,628 M1V probably null Het
Tas1r3 T G 4: 155,861,570 Q489P probably benign Het
Tas2r103 A T 6: 133,036,811 N97K probably damaging Het
Tas2r113 A G 6: 132,893,792 Y261C possibly damaging Het
Tex21 T C 12: 76,221,672 E112G probably damaging Het
Trappc8 T C 18: 20,832,998 S1128G probably damaging Het
Ubap1l A G 9: 65,371,743 probably benign Het
Ubash3a A G 17: 31,215,044 D121G probably damaging Het
Ubxn4 A G 1: 128,252,286 I56V possibly damaging Het
Uri1 T C 7: 37,963,524 I348M probably damaging Het
Usp21 C A 1: 171,283,722 L379F probably damaging Het
Vmn1r159 T A 7: 22,842,965 H214L probably damaging Het
Zdbf2 A G 1: 63,302,741 E93G unknown Het
Other mutations in Olfr638
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01412:Olfr638 APN 7 104003635 missense probably damaging 1.00
IGL01901:Olfr638 APN 7 104004067 missense probably damaging 1.00
IGL02040:Olfr638 APN 7 104003407 missense probably damaging 1.00
IGL02756:Olfr638 APN 7 104003659 missense probably damaging 1.00
R0122:Olfr638 UTSW 7 104003358 missense probably damaging 1.00
R0137:Olfr638 UTSW 7 104003502 missense probably benign 0.13
R0312:Olfr638 UTSW 7 104004025 missense probably damaging 1.00
R0650:Olfr638 UTSW 7 104003239 splice site probably null
R0652:Olfr638 UTSW 7 104003239 splice site probably null
R1382:Olfr638 UTSW 7 104003720 missense probably benign 0.01
R1723:Olfr638 UTSW 7 104003311 missense probably damaging 0.97
R1745:Olfr638 UTSW 7 104004063 missense probably benign 0.02
R1840:Olfr638 UTSW 7 104004117 missense probably benign 0.00
R3408:Olfr638 UTSW 7 104003343 nonsense probably null
R3413:Olfr638 UTSW 7 104003832 missense probably damaging 0.99
R4441:Olfr638 UTSW 7 104004072 missense probably damaging 1.00
R4727:Olfr638 UTSW 7 104003890 missense probably benign 0.00
R5096:Olfr638 UTSW 7 104003460 missense probably benign 0.08
R5851:Olfr638 UTSW 7 104003452 missense probably benign 0.13
R6133:Olfr638 UTSW 7 104003325 missense possibly damaging 0.58
R6529:Olfr638 UTSW 7 104003926 missense probably benign 0.06
R6572:Olfr638 UTSW 7 103999184 splice site probably null
R6799:Olfr638 UTSW 7 103998799 critical splice donor site probably null
R7267:Olfr638 UTSW 7 104003839 missense probably benign
R9140:Olfr638 UTSW 7 104004115 missense probably damaging 1.00
X0018:Olfr638 UTSW 7 104003431 missense probably benign
X0063:Olfr638 UTSW 7 104003527 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTGACATCAGAGTCAACAGATGGTACG -3'
(R):5'- AGCAAATGTTCCACTCCACATCCTTG -3'

Sequencing Primer
(F):5'- CAACAGATGGTACGGATTTGCTC -3'
(R):5'- CACTCCACATCCTTGTTATACAC -3'
Posted On 2014-05-14