Incidental Mutation 'R1700:Or51q1c'
ID 189656
Institutional Source Beutler Lab
Gene Symbol Or51q1c
Ensembl Gene ENSMUSG00000094063
Gene Name olfactory receptor family 51 subfamily Q member 1C
Synonyms Olfr638, MOR5-1, GA_x6K02T2PBJ9-6737723-6738670
MMRRC Submission 039733-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.175) question?
Stock # R1700 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 103652466-103653431 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 103653329 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 282 (Y282*)
Ref Sequence ENSEMBL: ENSMUSP00000151996 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000138055] [ENSMUST00000209757] [ENSMUST00000215653] [ENSMUST00000218325]
AlphaFold Q8VH20
Predicted Effect probably null
Transcript: ENSMUST00000098184
AA Change: Y288*
SMART Domains Protein: ENSMUSP00000095786
Gene: ENSMUSG00000094063
AA Change: Y288*

DomainStartEndE-ValueType
Pfam:7tm_4 39 318 2.6e-119 PFAM
Pfam:7TM_GPCR_Srsx 43 198 9.8e-10 PFAM
Pfam:7tm_1 49 300 7.8e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138055
SMART Domains Protein: ENSMUSP00000139240
Gene: ENSMUSG00000109824

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000209757
AA Change: Y288*
Predicted Effect probably benign
Transcript: ENSMUST00000215653
Predicted Effect probably null
Transcript: ENSMUST00000218325
AA Change: Y282*
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T C 5: 8,899,537 (GRCm39) F936L probably benign Het
Adamts12 T A 15: 11,152,143 (GRCm39) I211N probably benign Het
Adamts16 G A 13: 70,927,637 (GRCm39) probably benign Het
Alas1 C T 9: 106,116,845 (GRCm39) V293I possibly damaging Het
Ap1g1 T C 8: 110,580,244 (GRCm39) Y569H probably damaging Het
Apc2 A G 10: 80,148,603 (GRCm39) D1190G probably damaging Het
Astn2 G A 4: 65,664,591 (GRCm39) Q679* probably null Het
Atp2a1 T A 7: 126,062,081 (GRCm39) H5L probably damaging Het
Baiap3 T C 17: 25,468,302 (GRCm39) K279E probably damaging Het
C2cd2l G A 9: 44,227,909 (GRCm39) P111S probably benign Het
C7 T A 15: 5,032,274 (GRCm39) K646* probably null Het
Ccp110 C T 7: 118,334,536 (GRCm39) T1003I probably damaging Het
Cdh22 T C 2: 165,012,716 (GRCm39) D123G probably damaging Het
Cep295 C T 9: 15,252,179 (GRCm39) E397K probably damaging Het
Clip1 A G 5: 123,768,433 (GRCm39) V722A probably benign Het
Cpsf4l A G 11: 113,592,901 (GRCm39) F174S probably benign Het
Ctnna3 T C 10: 63,688,551 (GRCm39) C332R probably damaging Het
Cxcl10 A T 5: 92,495,714 (GRCm39) N76K probably damaging Het
Dnaaf9 G A 2: 130,551,858 (GRCm39) L1010F probably damaging Het
Dnaja3 G A 16: 4,502,029 (GRCm39) R11K probably null Het
Efcab10 A G 12: 33,445,170 (GRCm39) T28A possibly damaging Het
Esrrg A G 1: 187,775,850 (GRCm39) R103G probably damaging Het
Exosc2 A G 2: 31,560,818 (GRCm39) K23E probably benign Het
Flot2 C T 11: 77,940,373 (GRCm39) S40L possibly damaging Het
Fsip2 T C 2: 82,822,081 (GRCm39) V5938A probably benign Het
Gclc A G 9: 77,683,571 (GRCm39) T143A probably benign Het
Gpr37 A G 6: 25,669,623 (GRCm39) V407A probably benign Het
Gucy2e A T 11: 69,122,884 (GRCm39) M497K probably benign Het
Herc1 T A 9: 66,357,960 (GRCm39) probably null Het
Hnrnpll A C 17: 80,341,534 (GRCm39) S502A probably benign Het
Ipo11 G T 13: 106,932,170 (GRCm39) T975N probably benign Het
Kif17 C T 4: 137,990,009 (GRCm39) Q66* probably null Het
Lrp10 T C 14: 54,707,209 (GRCm39) V682A possibly damaging Het
Lsmem1 A T 12: 40,230,677 (GRCm39) L75Q probably damaging Het
Med16 A T 10: 79,735,169 (GRCm39) Y430N probably benign Het
Med8 C T 4: 118,269,931 (GRCm39) S72L possibly damaging Het
Mex3a A G 3: 88,443,682 (GRCm39) T253A probably damaging Het
Myf6 T C 10: 107,329,220 (GRCm39) K242E probably damaging Het
Ncald T A 15: 37,397,587 (GRCm39) Y31F probably benign Het
Ndufa12 T A 10: 94,035,855 (GRCm39) Y48N probably damaging Het
Or12e10 T C 2: 87,641,112 (GRCm39) V316A probably benign Het
Or5as1 T G 2: 86,980,123 (GRCm39) N294T probably damaging Het
Pde4dip T C 3: 97,610,639 (GRCm39) T1858A probably benign Het
Pgbd1 A G 13: 21,618,651 (GRCm39) L2P probably damaging Het
Piezo1 C T 8: 123,214,241 (GRCm39) R1642H probably damaging Het
Plxna1 A T 6: 89,333,990 (GRCm39) M213K probably damaging Het
Polr1b A G 2: 128,965,041 (GRCm39) N709S probably damaging Het
Pramel1 T A 4: 143,124,999 (GRCm39) W308R probably damaging Het
Prkag2 A T 5: 25,076,539 (GRCm39) I208N probably damaging Het
Ptpro T A 6: 137,420,592 (GRCm39) V1007D probably damaging Het
Rngtt T A 4: 33,330,864 (GRCm39) F156I probably damaging Het
Rpusd3 A G 6: 113,392,494 (GRCm39) *345Q probably null Het
Rrp1b A G 17: 32,276,178 (GRCm39) K575R probably benign Het
Shd G A 17: 56,281,307 (GRCm39) V250I probably damaging Het
Slc12a5 C A 2: 164,834,296 (GRCm39) N749K possibly damaging Het
Sorbs2 T A 8: 46,254,021 (GRCm39) V488D probably damaging Het
Sphkap G A 1: 83,255,236 (GRCm39) R838* probably null Het
Srsf4 C A 4: 131,627,871 (GRCm39) probably benign Het
Strn T C 17: 78,999,831 (GRCm39) Y135C probably damaging Het
Synm T C 7: 67,409,376 (GRCm39) M1V probably null Het
Tas1r3 T G 4: 155,946,027 (GRCm39) Q489P probably benign Het
Tas2r103 A T 6: 133,013,774 (GRCm39) N97K probably damaging Het
Tas2r113 A G 6: 132,870,755 (GRCm39) Y261C possibly damaging Het
Tex21 T C 12: 76,268,446 (GRCm39) E112G probably damaging Het
Trappc8 T C 18: 20,966,055 (GRCm39) S1128G probably damaging Het
Ubap1l A G 9: 65,279,025 (GRCm39) probably benign Het
Ubash3a A G 17: 31,434,018 (GRCm39) D121G probably damaging Het
Ubxn4 A G 1: 128,180,023 (GRCm39) I56V possibly damaging Het
Uri1 T C 7: 37,662,949 (GRCm39) I348M probably damaging Het
Usp21 C A 1: 171,111,295 (GRCm39) L379F probably damaging Het
Vmn1r159 T A 7: 22,542,390 (GRCm39) H214L probably damaging Het
Zdbf2 A G 1: 63,341,900 (GRCm39) E93G unknown Het
Other mutations in Or51q1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01412:Or51q1c APN 7 103,652,842 (GRCm39) missense probably damaging 1.00
IGL01901:Or51q1c APN 7 103,653,274 (GRCm39) missense probably damaging 1.00
IGL02040:Or51q1c APN 7 103,652,614 (GRCm39) missense probably damaging 1.00
IGL02756:Or51q1c APN 7 103,652,866 (GRCm39) missense probably damaging 1.00
R0122:Or51q1c UTSW 7 103,652,565 (GRCm39) missense probably damaging 1.00
R0137:Or51q1c UTSW 7 103,652,709 (GRCm39) missense probably benign 0.13
R0312:Or51q1c UTSW 7 103,653,232 (GRCm39) missense probably damaging 1.00
R0650:Or51q1c UTSW 7 103,652,446 (GRCm39) splice site probably null
R0652:Or51q1c UTSW 7 103,652,446 (GRCm39) splice site probably null
R1382:Or51q1c UTSW 7 103,652,927 (GRCm39) missense probably benign 0.01
R1723:Or51q1c UTSW 7 103,652,518 (GRCm39) missense probably damaging 0.97
R1745:Or51q1c UTSW 7 103,653,270 (GRCm39) missense probably benign 0.02
R1840:Or51q1c UTSW 7 103,653,324 (GRCm39) missense probably benign 0.00
R3408:Or51q1c UTSW 7 103,652,550 (GRCm39) nonsense probably null
R3413:Or51q1c UTSW 7 103,653,039 (GRCm39) missense probably damaging 0.99
R4441:Or51q1c UTSW 7 103,653,279 (GRCm39) missense probably damaging 1.00
R4727:Or51q1c UTSW 7 103,653,097 (GRCm39) missense probably benign 0.00
R5096:Or51q1c UTSW 7 103,652,667 (GRCm39) missense probably benign 0.08
R5851:Or51q1c UTSW 7 103,652,659 (GRCm39) missense probably benign 0.13
R6133:Or51q1c UTSW 7 103,652,532 (GRCm39) missense possibly damaging 0.58
R6529:Or51q1c UTSW 7 103,653,133 (GRCm39) missense probably benign 0.06
R6572:Or51q1c UTSW 7 103,648,391 (GRCm39) splice site probably null
R6799:Or51q1c UTSW 7 103,648,006 (GRCm39) critical splice donor site probably null
R7267:Or51q1c UTSW 7 103,653,046 (GRCm39) missense probably benign
R9140:Or51q1c UTSW 7 103,653,322 (GRCm39) missense probably damaging 1.00
X0018:Or51q1c UTSW 7 103,652,638 (GRCm39) missense probably benign
X0063:Or51q1c UTSW 7 103,652,734 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTGACATCAGAGTCAACAGATGGTACG -3'
(R):5'- AGCAAATGTTCCACTCCACATCCTTG -3'

Sequencing Primer
(F):5'- CAACAGATGGTACGGATTTGCTC -3'
(R):5'- CACTCCACATCCTTGTTATACAC -3'
Posted On 2014-05-14