Mutagenetix > Incidental Mutation

Incidental Mutation 'R1700:Cep295'

189662

Institutional Source

Beutler Lab

Gene Symbol

Cep295

Ensembl Gene

ENSMUSG00000046111

Gene Name

centrosomal protein 295

Synonyms

LOC382128, 5830418K08Rik

MMRRC Submission

039733-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.948) question?

Stock #

R1700 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

15316915-15357788 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 15340883 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Lysine at position 397 (E397K)

Ref Sequence

ENSEMBL: ENSMUSP00000096578 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000098979] [ENSMUST00000161132]

AlphaFold

no structure available at present

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000059410

Predicted Effect

probably damaging
Transcript: ENSMUST00000098979
AA Change: E397K

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000096578
Gene: ENSMUSG00000046111
AA Change: E397K

Domain	Start	End	E-Value	Type
low complexity region	159	175	N/A	INTRINSIC
coiled coil region	258	288	N/A	INTRINSIC
coiled coil region	536	583	N/A	INTRINSIC
coiled coil region	861	889	N/A	INTRINSIC
internal_repeat_1	890	1104	6.8e-5	PROSPERO
internal_repeat_1	1277	1489	6.8e-5	PROSPERO
low complexity region	1537	1548	N/A	INTRINSIC
low complexity region	1611	1625	N/A	INTRINSIC
coiled coil region	1707	1736	N/A	INTRINSIC
low complexity region	2003	2018	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000161132
AA Change: E397K

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000123788
Gene: ENSMUSG00000046111
AA Change: E397K

Domain	Start	End	E-Value	Type
low complexity region	111	127	N/A	INTRINSIC
coiled coil region	210	240	N/A	INTRINSIC
coiled coil region	488	535	N/A	INTRINSIC
coiled coil region	813	841	N/A	INTRINSIC
coiled coil region	1300	1327	N/A	INTRINSIC
low complexity region	1489	1500	N/A	INTRINSIC
low complexity region	1563	1577	N/A	INTRINSIC
coiled coil region	1659	1688	N/A	INTRINSIC
low complexity region	2035	2050	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000161795
AA Change: E349K

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000125035
Gene: ENSMUSG00000046111
AA Change: E349K

Domain	Start	End	E-Value	Type
low complexity region	111	127	N/A	INTRINSIC
coiled coil region	210	240	N/A	INTRINSIC
coiled coil region	488	535	N/A	INTRINSIC
coiled coil region	813	841	N/A	INTRINSIC
internal_repeat_1	842	1056	7.14e-5	PROSPERO
internal_repeat_1	1229	1441	7.14e-5	PROSPERO
low complexity region	1489	1500	N/A	INTRINSIC
low complexity region	1563	1577	N/A	INTRINSIC
coiled coil region	1659	1688	N/A	INTRINSIC
low complexity region	1955	1970	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162689

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000163010

Meta Mutation Damage Score

0.1905

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.4%
20x: 92.8%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930402H24Rik	G	A	2: 130,709,938	L1010F	probably damaging	Het
Abcb1b	T	C	5: 8,849,537	F936L	probably benign	Het
Adamts12	T	A	15: 11,152,057	I211N	probably benign	Het
Adamts16	G	A	13: 70,779,518		probably benign	Het
Alas1	C	T	9: 106,239,646	V293I	possibly damaging	Het
Ap1g1	T	C	8: 109,853,612	Y569H	probably damaging	Het
Apc2	A	G	10: 80,312,769	D1190G	probably damaging	Het
Astn2	G	A	4: 65,746,354	Q679*	probably null	Het
Atp2a1	T	A	7: 126,462,909	H5L	probably damaging	Het
Baiap3	T	C	17: 25,249,328	K279E	probably damaging	Het
C2cd2l	G	A	9: 44,316,612	P111S	probably benign	Het
C7	T	A	15: 5,002,792	K646*	probably null	Het
Ccp110	C	T	7: 118,735,313	T1003I	probably damaging	Het
Cdh22	T	C	2: 165,170,796	D123G	probably damaging	Het
Clip1	A	G	5: 123,630,370	V722A	probably benign	Het
Cpsf4l	A	G	11: 113,702,075	F174S	probably benign	Het
Ctnna3	T	C	10: 63,852,772	C332R	probably damaging	Het
Cxcl10	A	T	5: 92,347,855	N76K	probably damaging	Het
Dnaja3	G	A	16: 4,684,165	R11K	probably null	Het
Efcab10	A	G	12: 33,395,171	T28A	possibly damaging	Het
Esrrg	A	G	1: 188,043,653	R103G	probably damaging	Het
Exosc2	A	G	2: 31,670,806	K23E	probably benign	Het
Flot2	C	T	11: 78,049,547	S40L	possibly damaging	Het
Fsip2	T	C	2: 82,991,737	V5938A	probably benign	Het
Gclc	A	G	9: 77,776,289	T143A	probably benign	Het
Gpr37	A	G	6: 25,669,624	V407A	probably benign	Het
Gucy2e	A	T	11: 69,232,058	M497K	probably benign	Het
Herc1	T	A	9: 66,450,678		probably null	Het
Hnrnpll	A	C	17: 80,034,105	S502A	probably benign	Het
Ipo11	G	T	13: 106,795,662	T975N	probably benign	Het
Kif17	C	T	4: 138,262,698	Q66*	probably null	Het
Lrp10	T	C	14: 54,469,752	V682A	possibly damaging	Het
Lsmem1	A	T	12: 40,180,678	L75Q	probably damaging	Het
Med16	A	T	10: 79,899,335	Y430N	probably benign	Het
Med8	C	T	4: 118,412,734	S72L	possibly damaging	Het
Mex3a	A	G	3: 88,536,375	T253A	probably damaging	Het
Myf6	T	C	10: 107,493,359	K242E	probably damaging	Het
Ncald	T	A	15: 37,397,343	Y31F	probably benign	Het
Ndufa12	T	A	10: 94,199,993	Y48N	probably damaging	Het
Olfr1111	T	G	2: 87,149,779	N294T	probably damaging	Het
Olfr1145	T	C	2: 87,810,768	V316A	probably benign	Het
Olfr638	T	A	7: 104,004,122	Y282*	probably null	Het
Pde4dip	T	C	3: 97,703,323	T1858A	probably benign	Het
Pgbd1	A	G	13: 21,434,481	L2P	probably damaging	Het
Piezo1	C	T	8: 122,487,502	R1642H	probably damaging	Het
Plxna1	A	T	6: 89,357,008	M213K	probably damaging	Het
Polr1b	A	G	2: 129,123,121	N709S	probably damaging	Het
Pramel1	T	A	4: 143,398,429	W308R	probably damaging	Het
Prkag2	A	T	5: 24,871,541	I208N	probably damaging	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Rngtt	T	A	4: 33,330,864	F156I	probably damaging	Het
Rpusd3	A	G	6: 113,415,533	*345Q	probably null	Het
Rrp1b	A	G	17: 32,057,204	K575R	probably benign	Het
Shd	G	A	17: 55,974,307	V250I	probably damaging	Het
Slc12a5	C	A	2: 164,992,376	N749K	possibly damaging	Het
Sorbs2	T	A	8: 45,800,984	V488D	probably damaging	Het
Sphkap	G	A	1: 83,277,515	R838*	probably null	Het
Srsf4	C	A	4: 131,900,560		probably benign	Het
Strn	T	C	17: 78,692,402	Y135C	probably damaging	Het
Synm	T	C	7: 67,759,628	M1V	probably null	Het
Tas1r3	T	G	4: 155,861,570	Q489P	probably benign	Het
Tas2r103	A	T	6: 133,036,811	N97K	probably damaging	Het
Tas2r113	A	G	6: 132,893,792	Y261C	possibly damaging	Het
Tex21	T	C	12: 76,221,672	E112G	probably damaging	Het
Trappc8	T	C	18: 20,832,998	S1128G	probably damaging	Het
Ubap1l	A	G	9: 65,371,743		probably benign	Het
Ubash3a	A	G	17: 31,215,044	D121G	probably damaging	Het
Ubxn4	A	G	1: 128,252,286	I56V	possibly damaging	Het
Uri1	T	C	7: 37,963,524	I348M	probably damaging	Het
Usp21	C	A	1: 171,283,722	L379F	probably damaging	Het
Vmn1r159	T	A	7: 22,842,965	H214L	probably damaging	Het
Zdbf2	A	G	1: 63,302,741	E93G	unknown	Het

Other mutations in Cep295

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00337:Cep295	APN	9	15326072	splice site	probably null
IGL00769:Cep295	APN	9	15326144	missense	probably damaging	1.00
IGL00771:Cep295	APN	9	15322565	missense	probably damaging	1.00
IGL00850:Cep295	APN	9	15322852	missense	probably benign	0.36
IGL01505:Cep295	APN	9	15318049	missense	probably benign	0.08
IGL01510:Cep295	APN	9	15354626	nonsense	probably null
IGL01759:Cep295	APN	9	15323559	splice site	probably null
IGL02415:Cep295	APN	9	15353020	missense	probably damaging	1.00
IGL02447:Cep295	APN	9	15332511	missense	probably damaging	0.98
IGL02502:Cep295	APN	9	15350913	splice site	probably benign
IGL02665:Cep295	APN	9	15326632	splice site	probably benign
IGL02718:Cep295	APN	9	15325753	splice site	probably null
IGL02995:Cep295	APN	9	15333312	missense	probably damaging	1.00
IGL03024:Cep295	APN	9	15325572	missense	probably benign
R0196:Cep295	UTSW	9	15338213	missense	probably damaging	0.96
R0398:Cep295	UTSW	9	15354736	missense	possibly damaging	0.90
R0595:Cep295	UTSW	9	15332191	nonsense	probably null
R0610:Cep295	UTSW	9	15322754	missense	possibly damaging	0.81
R0616:Cep295	UTSW	9	15332322	nonsense	probably null
R0840:Cep295	UTSW	9	15334315	missense	probably benign	0.02
R1215:Cep295	UTSW	9	15327882	missense	probably benign	0.00
R1376:Cep295	UTSW	9	15340868	splice site	probably benign
R1381:Cep295	UTSW	9	15322565	missense	probably benign	0.02
R1484:Cep295	UTSW	9	15334784	missense	probably damaging	0.99
R1557:Cep295	UTSW	9	15332010	nonsense	probably null
R1655:Cep295	UTSW	9	15340883	missense	probably damaging	0.99
R1682:Cep295	UTSW	9	15333921	missense	probably benign	0.02
R1734:Cep295	UTSW	9	15340883	missense	probably damaging	0.99
R1736:Cep295	UTSW	9	15340883	missense	probably damaging	0.99
R1743:Cep295	UTSW	9	15340883	missense	probably damaging	0.99
R1765:Cep295	UTSW	9	15327904	missense	probably damaging	1.00
R1889:Cep295	UTSW	9	15332103	missense	possibly damaging	0.94
R1895:Cep295	UTSW	9	15332103	missense	possibly damaging	0.94
R1994:Cep295	UTSW	9	15340883	missense	probably damaging	0.99
R1995:Cep295	UTSW	9	15340883	missense	probably damaging	0.99
R2071:Cep295	UTSW	9	15341564	missense	probably damaging	1.00
R2161:Cep295	UTSW	9	15353058	missense	probably damaging	0.99
R2195:Cep295	UTSW	9	15332321	missense	probably damaging	0.99
R2354:Cep295	UTSW	9	15334784	missense	possibly damaging	0.92
R2427:Cep295	UTSW	9	15334238	missense	probably damaging	1.00
R2992:Cep295	UTSW	9	15332747	missense	probably damaging	1.00
R3873:Cep295	UTSW	9	15333365	missense	probably damaging	1.00
R3981:Cep295	UTSW	9	15317067	utr 3 prime	probably benign
R4201:Cep295	UTSW	9	15332538	missense	probably benign	0.19
R4297:Cep295	UTSW	9	15322654	missense	probably benign	0.19
R4543:Cep295	UTSW	9	15335253	missense	possibly damaging	0.94
R4584:Cep295	UTSW	9	15334799	missense	possibly damaging	0.96
R4724:Cep295	UTSW	9	15330832	missense	probably damaging	1.00
R4878:Cep295	UTSW	9	15334956	missense	probably benign	0.11
R4884:Cep295	UTSW	9	15351760	missense	probably damaging	1.00
R4934:Cep295	UTSW	9	15333160	missense	probably damaging	0.97
R4990:Cep295	UTSW	9	15332138	missense	probably damaging	1.00
R5057:Cep295	UTSW	9	15322683	missense	probably benign	0.00
R5153:Cep295	UTSW	9	15357629	missense	probably benign	0.32
R5180:Cep295	UTSW	9	15332120	missense	probably benign
R5285:Cep295	UTSW	9	15322591	missense	probably benign	0.14
R5360:Cep295	UTSW	9	15326733	missense	probably damaging	1.00
R5419:Cep295	UTSW	9	15324237	missense	probably damaging	0.98
R5432:Cep295	UTSW	9	15351695	missense	possibly damaging	0.95
R5625:Cep295	UTSW	9	15340891	missense	probably damaging	0.99
R5637:Cep295	UTSW	9	15333812	splice site	probably null
R5645:Cep295	UTSW	9	15332794	missense	probably damaging	0.98
R5645:Cep295	UTSW	9	15335108	missense	possibly damaging	0.89
R5678:Cep295	UTSW	9	15322858	missense	probably damaging	0.99
R5688:Cep295	UTSW	9	15331986	missense	probably damaging	1.00
R5807:Cep295	UTSW	9	15332532	missense	probably damaging	1.00
R5824:Cep295	UTSW	9	15325656	missense	possibly damaging	0.90
R5837:Cep295	UTSW	9	15346984	missense	probably damaging	0.99
R5915:Cep295	UTSW	9	15341479	missense	probably damaging	1.00
R5988:Cep295	UTSW	9	15341474	missense	probably damaging	1.00
R6239:Cep295	UTSW	9	15322631	missense	possibly damaging	0.46
R6332:Cep295	UTSW	9	15334914	missense	possibly damaging	0.90
R6383:Cep295	UTSW	9	15332754	missense	probably damaging	0.99
R6737:Cep295	UTSW	9	15332351	missense	possibly damaging	0.90
R6929:Cep295	UTSW	9	15333062	missense	probably damaging	1.00
R7428:Cep295	UTSW	9	15333498	missense	possibly damaging	0.61
R7697:Cep295	UTSW	9	15354710	missense	probably benign	0.01
R7963:Cep295	UTSW	9	15333441	missense	possibly damaging	0.90
R8055:Cep295	UTSW	9	15333609	missense	probably benign	0.00
R8069:Cep295	UTSW	9	15322586	missense	possibly damaging	0.94
R8092:Cep295	UTSW	9	15332982	missense	probably benign	0.17
R8117:Cep295	UTSW	9	15334364	missense	probably damaging	0.99
R8140:Cep295	UTSW	9	15341533	missense	probably benign	0.00
R8178:Cep295	UTSW	9	15333540	missense
R8323:Cep295	UTSW	9	15338233	missense	possibly damaging	0.53
R8323:Cep295	UTSW	9	15353061	missense	probably damaging	0.96
R8339:Cep295	UTSW	9	15325550	missense
R8351:Cep295	UTSW	9	15322906	missense	probably damaging	0.99
R8367:Cep295	UTSW	9	15334530	missense	probably benign	0.09
R8725:Cep295	UTSW	9	15332419	nonsense	probably null
R8919:Cep295	UTSW	9	15326711	missense	probably damaging	1.00
R9015:Cep295	UTSW	9	15332968	missense	probably benign	0.00
R9054:Cep295	UTSW	9	15324255	missense	possibly damaging	0.92
R9088:Cep295	UTSW	9	15322519	missense	probably benign	0.09
R9159:Cep295	UTSW	9	15341608	missense	probably benign	0.05
R9243:Cep295	UTSW	9	15332309	missense	probably benign	0.36
R9408:Cep295	UTSW	9	15333323	missense	probably benign	0.00
R9424:Cep295	UTSW	9	15333203	missense	probably damaging	0.98
R9455:Cep295	UTSW	9	15333750	missense	possibly damaging	0.90
R9607:Cep295	UTSW	9	15322713	missense	probably damaging	0.98
R9648:Cep295	UTSW	9	15323607	missense	probably benign	0.00
R9659:Cep295	UTSW	9	15322550	missense	probably benign	0.19
R9731:Cep295	UTSW	9	15333966	missense	possibly damaging	0.94
X0065:Cep295	UTSW	9	15322891	missense	probably benign	0.36
Z1176:Cep295	UTSW	9	15357697	missense	probably damaging	0.99
Z1177:Cep295	UTSW	9	15330817	missense

Predicted Primers

PCR Primer
(F):5'- GGACCTGATCTCCAATGGCAGAAAC -3'
(R):5'- AGGGACTGTCACCAGTGCTTTTAAATG -3'

Sequencing Primer
(F):5'- CAGACATGCAGAGTAGCAATGC -3'
(R):5'- agccatctcaccagccc -3'

Posted On

2014-05-14