Incidental Mutation 'R1700:C2cd2l'
ID189663
Institutional Source Beutler Lab
Gene Symbol C2cd2l
Ensembl Gene ENSMUSG00000032120
Gene NameC2 calcium-dependent domain containing 2-like
Synonyms1300006O23Rik, Tmem24
MMRRC Submission 039733-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R1700 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location44309237-44320285 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 44316612 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 111 (P111S)
Ref Sequence ENSEMBL: ENSMUSP00000149342 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065080] [ENSMUST00000213160] [ENSMUST00000214602] [ENSMUST00000216222]
Predicted Effect probably benign
Transcript: ENSMUST00000065080
AA Change: P233S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000065233
Gene: ENSMUSG00000032120
AA Change: P233S

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
low complexity region 67 79 N/A INTRINSIC
SCOP:d1qasa2 284 408 4e-3 SMART
Blast:C2 287 395 9e-62 BLAST
low complexity region 417 430 N/A INTRINSIC
low complexity region 444 452 N/A INTRINSIC
low complexity region 483 503 N/A INTRINSIC
low complexity region 566 587 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000213160
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213298
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213689
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213818
Predicted Effect probably benign
Transcript: ENSMUST00000214602
AA Change: P233S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214915
Predicted Effect probably benign
Transcript: ENSMUST00000216222
AA Change: P111S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216855
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik G A 2: 130,709,938 L1010F probably damaging Het
Abcb1b T C 5: 8,849,537 F936L probably benign Het
Adamts12 T A 15: 11,152,057 I211N probably benign Het
Adamts16 G A 13: 70,779,518 probably benign Het
Alas1 C T 9: 106,239,646 V293I possibly damaging Het
Ap1g1 T C 8: 109,853,612 Y569H probably damaging Het
Apc2 A G 10: 80,312,769 D1190G probably damaging Het
Astn2 G A 4: 65,746,354 Q679* probably null Het
Atp2a1 T A 7: 126,462,909 H5L probably damaging Het
Baiap3 T C 17: 25,249,328 K279E probably damaging Het
C7 T A 15: 5,002,792 K646* probably null Het
Ccp110 C T 7: 118,735,313 T1003I probably damaging Het
Cdh22 T C 2: 165,170,796 D123G probably damaging Het
Cep295 C T 9: 15,340,883 E397K probably damaging Het
Clip1 A G 5: 123,630,370 V722A probably benign Het
Cpsf4l A G 11: 113,702,075 F174S probably benign Het
Ctnna3 T C 10: 63,852,772 C332R probably damaging Het
Cxcl10 A T 5: 92,347,855 N76K probably damaging Het
Dnaja3 G A 16: 4,684,165 R11K probably null Het
Efcab10 A G 12: 33,395,171 T28A possibly damaging Het
Esrrg A G 1: 188,043,653 R103G probably damaging Het
Exosc2 A G 2: 31,670,806 K23E probably benign Het
Flot2 C T 11: 78,049,547 S40L possibly damaging Het
Fsip2 T C 2: 82,991,737 V5938A probably benign Het
Gclc A G 9: 77,776,289 T143A probably benign Het
Gpr37 A G 6: 25,669,624 V407A probably benign Het
Gucy2e A T 11: 69,232,058 M497K probably benign Het
Herc1 T A 9: 66,450,678 probably null Het
Hnrnpll A C 17: 80,034,105 S502A probably benign Het
Ipo11 G T 13: 106,795,662 T975N probably benign Het
Kif17 C T 4: 138,262,698 Q66* probably null Het
Lrp10 T C 14: 54,469,752 V682A possibly damaging Het
Lsmem1 A T 12: 40,180,678 L75Q probably damaging Het
Med16 A T 10: 79,899,335 Y430N probably benign Het
Med8 C T 4: 118,412,734 S72L possibly damaging Het
Mex3a A G 3: 88,536,375 T253A probably damaging Het
Myf6 T C 10: 107,493,359 K242E probably damaging Het
Ncald T A 15: 37,397,343 Y31F probably benign Het
Ndufa12 T A 10: 94,199,993 Y48N probably damaging Het
Olfr1111 T G 2: 87,149,779 N294T probably damaging Het
Olfr1145 T C 2: 87,810,768 V316A probably benign Het
Olfr638 T A 7: 104,004,122 Y282* probably null Het
Pde4dip T C 3: 97,703,323 T1858A probably benign Het
Pgbd1 A G 13: 21,434,481 L2P probably damaging Het
Piezo1 C T 8: 122,487,502 R1642H probably damaging Het
Plxna1 A T 6: 89,357,008 M213K probably damaging Het
Polr1b A G 2: 129,123,121 N709S probably damaging Het
Pramel1 T A 4: 143,398,429 W308R probably damaging Het
Prkag2 A T 5: 24,871,541 I208N probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rngtt T A 4: 33,330,864 F156I probably damaging Het
Rpusd3 A G 6: 113,415,533 *345Q probably null Het
Rrp1b A G 17: 32,057,204 K575R probably benign Het
Shd G A 17: 55,974,307 V250I probably damaging Het
Slc12a5 C A 2: 164,992,376 N749K possibly damaging Het
Sorbs2 T A 8: 45,800,984 V488D probably damaging Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Srsf4 C A 4: 131,900,560 probably benign Het
Strn T C 17: 78,692,402 Y135C probably damaging Het
Synm T C 7: 67,759,628 M1V probably null Het
Tas1r3 T G 4: 155,861,570 Q489P probably benign Het
Tas2r103 A T 6: 133,036,811 N97K probably damaging Het
Tas2r113 A G 6: 132,893,792 Y261C possibly damaging Het
Tex21 T C 12: 76,221,672 E112G probably damaging Het
Trappc8 T C 18: 20,832,998 S1128G probably damaging Het
Ubap1l A G 9: 65,371,743 probably benign Het
Ubash3a A G 17: 31,215,044 D121G probably damaging Het
Ubxn4 A G 1: 128,252,286 I56V possibly damaging Het
Uri1 T C 7: 37,963,524 I348M probably damaging Het
Usp21 C A 1: 171,283,722 L379F probably damaging Het
Vmn1r159 T A 7: 22,842,965 H214L probably damaging Het
Zdbf2 A G 1: 63,302,741 E93G unknown Het
Other mutations in C2cd2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00472:C2cd2l APN 9 44317103 missense probably damaging 1.00
IGL01304:C2cd2l APN 9 44319587 missense probably damaging 0.96
IGL02402:C2cd2l APN 9 44316581 missense probably benign 0.31
R0701:C2cd2l UTSW 9 44316202 missense probably damaging 1.00
R0883:C2cd2l UTSW 9 44316202 missense probably damaging 1.00
R1321:C2cd2l UTSW 9 44317581 critical splice donor site probably null
R1594:C2cd2l UTSW 9 44316773 missense probably damaging 1.00
R1665:C2cd2l UTSW 9 44316775 missense probably benign 0.07
R1739:C2cd2l UTSW 9 44319743 missense probably benign 0.26
R1770:C2cd2l UTSW 9 44316811 missense probably benign 0.02
R2065:C2cd2l UTSW 9 44316335 missense probably benign 0.19
R4669:C2cd2l UTSW 9 44315025 missense possibly damaging 0.92
R4835:C2cd2l UTSW 9 44315145 critical splice donor site probably null
R4890:C2cd2l UTSW 9 44311133 missense probably damaging 1.00
R4916:C2cd2l UTSW 9 44316560 missense probably damaging 0.97
R5664:C2cd2l UTSW 9 44313772 missense probably damaging 1.00
R6268:C2cd2l UTSW 9 44317666 missense probably damaging 1.00
R6339:C2cd2l UTSW 9 44313491 splice site probably benign
R7043:C2cd2l UTSW 9 44316551 missense probably damaging 1.00
R7236:C2cd2l UTSW 9 44317663 missense possibly damaging 0.71
R7532:C2cd2l UTSW 9 44315384 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- AGATGCTCGAAGCTGCCGTAAG -3'
(R):5'- TCAGCCTGGAGGAAATCCCTGATG -3'

Sequencing Primer
(F):5'- TCGAAGCTGCCGTAAGAATAATC -3'
(R):5'- GAAATCCCTGATGAGGGGC -3'
Posted On2014-05-14