Incidental Mutation 'R1700:C2cd2l'
ID 189663
Institutional Source Beutler Lab
Gene Symbol C2cd2l
Ensembl Gene ENSMUSG00000032120
Gene Name C2 calcium-dependent domain containing 2-like
Synonyms Tmem24, 1300006O23Rik
MMRRC Submission 039733-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.115) question?
Stock # R1700 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 44220534-44231579 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 44227909 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 111 (P111S)
Ref Sequence ENSEMBL: ENSMUSP00000149342 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065080] [ENSMUST00000213160] [ENSMUST00000214602] [ENSMUST00000216222]
AlphaFold Q80X80
Predicted Effect probably benign
Transcript: ENSMUST00000065080
AA Change: P233S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000065233
Gene: ENSMUSG00000032120
AA Change: P233S

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
low complexity region 67 79 N/A INTRINSIC
SCOP:d1qasa2 284 408 4e-3 SMART
Blast:C2 287 395 9e-62 BLAST
low complexity region 417 430 N/A INTRINSIC
low complexity region 444 452 N/A INTRINSIC
low complexity region 483 503 N/A INTRINSIC
low complexity region 566 587 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000213160
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213298
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213689
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213818
Predicted Effect probably benign
Transcript: ENSMUST00000214602
AA Change: P233S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000216222
AA Change: P111S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216855
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214915
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T C 5: 8,899,537 (GRCm39) F936L probably benign Het
Adamts12 T A 15: 11,152,143 (GRCm39) I211N probably benign Het
Adamts16 G A 13: 70,927,637 (GRCm39) probably benign Het
Alas1 C T 9: 106,116,845 (GRCm39) V293I possibly damaging Het
Ap1g1 T C 8: 110,580,244 (GRCm39) Y569H probably damaging Het
Apc2 A G 10: 80,148,603 (GRCm39) D1190G probably damaging Het
Astn2 G A 4: 65,664,591 (GRCm39) Q679* probably null Het
Atp2a1 T A 7: 126,062,081 (GRCm39) H5L probably damaging Het
Baiap3 T C 17: 25,468,302 (GRCm39) K279E probably damaging Het
C7 T A 15: 5,032,274 (GRCm39) K646* probably null Het
Ccp110 C T 7: 118,334,536 (GRCm39) T1003I probably damaging Het
Cdh22 T C 2: 165,012,716 (GRCm39) D123G probably damaging Het
Cep295 C T 9: 15,252,179 (GRCm39) E397K probably damaging Het
Clip1 A G 5: 123,768,433 (GRCm39) V722A probably benign Het
Cpsf4l A G 11: 113,592,901 (GRCm39) F174S probably benign Het
Ctnna3 T C 10: 63,688,551 (GRCm39) C332R probably damaging Het
Cxcl10 A T 5: 92,495,714 (GRCm39) N76K probably damaging Het
Dnaaf9 G A 2: 130,551,858 (GRCm39) L1010F probably damaging Het
Dnaja3 G A 16: 4,502,029 (GRCm39) R11K probably null Het
Efcab10 A G 12: 33,445,170 (GRCm39) T28A possibly damaging Het
Esrrg A G 1: 187,775,850 (GRCm39) R103G probably damaging Het
Exosc2 A G 2: 31,560,818 (GRCm39) K23E probably benign Het
Flot2 C T 11: 77,940,373 (GRCm39) S40L possibly damaging Het
Fsip2 T C 2: 82,822,081 (GRCm39) V5938A probably benign Het
Gclc A G 9: 77,683,571 (GRCm39) T143A probably benign Het
Gpr37 A G 6: 25,669,623 (GRCm39) V407A probably benign Het
Gucy2e A T 11: 69,122,884 (GRCm39) M497K probably benign Het
Herc1 T A 9: 66,357,960 (GRCm39) probably null Het
Hnrnpll A C 17: 80,341,534 (GRCm39) S502A probably benign Het
Ipo11 G T 13: 106,932,170 (GRCm39) T975N probably benign Het
Kif17 C T 4: 137,990,009 (GRCm39) Q66* probably null Het
Lrp10 T C 14: 54,707,209 (GRCm39) V682A possibly damaging Het
Lsmem1 A T 12: 40,230,677 (GRCm39) L75Q probably damaging Het
Med16 A T 10: 79,735,169 (GRCm39) Y430N probably benign Het
Med8 C T 4: 118,269,931 (GRCm39) S72L possibly damaging Het
Mex3a A G 3: 88,443,682 (GRCm39) T253A probably damaging Het
Myf6 T C 10: 107,329,220 (GRCm39) K242E probably damaging Het
Ncald T A 15: 37,397,587 (GRCm39) Y31F probably benign Het
Ndufa12 T A 10: 94,035,855 (GRCm39) Y48N probably damaging Het
Or12e10 T C 2: 87,641,112 (GRCm39) V316A probably benign Het
Or51q1c T A 7: 103,653,329 (GRCm39) Y282* probably null Het
Or5as1 T G 2: 86,980,123 (GRCm39) N294T probably damaging Het
Pde4dip T C 3: 97,610,639 (GRCm39) T1858A probably benign Het
Pgbd1 A G 13: 21,618,651 (GRCm39) L2P probably damaging Het
Piezo1 C T 8: 123,214,241 (GRCm39) R1642H probably damaging Het
Plxna1 A T 6: 89,333,990 (GRCm39) M213K probably damaging Het
Polr1b A G 2: 128,965,041 (GRCm39) N709S probably damaging Het
Pramel1 T A 4: 143,124,999 (GRCm39) W308R probably damaging Het
Prkag2 A T 5: 25,076,539 (GRCm39) I208N probably damaging Het
Ptpro T A 6: 137,420,592 (GRCm39) V1007D probably damaging Het
Rngtt T A 4: 33,330,864 (GRCm39) F156I probably damaging Het
Rpusd3 A G 6: 113,392,494 (GRCm39) *345Q probably null Het
Rrp1b A G 17: 32,276,178 (GRCm39) K575R probably benign Het
Shd G A 17: 56,281,307 (GRCm39) V250I probably damaging Het
Slc12a5 C A 2: 164,834,296 (GRCm39) N749K possibly damaging Het
Sorbs2 T A 8: 46,254,021 (GRCm39) V488D probably damaging Het
Sphkap G A 1: 83,255,236 (GRCm39) R838* probably null Het
Srsf4 C A 4: 131,627,871 (GRCm39) probably benign Het
Strn T C 17: 78,999,831 (GRCm39) Y135C probably damaging Het
Synm T C 7: 67,409,376 (GRCm39) M1V probably null Het
Tas1r3 T G 4: 155,946,027 (GRCm39) Q489P probably benign Het
Tas2r103 A T 6: 133,013,774 (GRCm39) N97K probably damaging Het
Tas2r113 A G 6: 132,870,755 (GRCm39) Y261C possibly damaging Het
Tex21 T C 12: 76,268,446 (GRCm39) E112G probably damaging Het
Trappc8 T C 18: 20,966,055 (GRCm39) S1128G probably damaging Het
Ubap1l A G 9: 65,279,025 (GRCm39) probably benign Het
Ubash3a A G 17: 31,434,018 (GRCm39) D121G probably damaging Het
Ubxn4 A G 1: 128,180,023 (GRCm39) I56V possibly damaging Het
Uri1 T C 7: 37,662,949 (GRCm39) I348M probably damaging Het
Usp21 C A 1: 171,111,295 (GRCm39) L379F probably damaging Het
Vmn1r159 T A 7: 22,542,390 (GRCm39) H214L probably damaging Het
Zdbf2 A G 1: 63,341,900 (GRCm39) E93G unknown Het
Other mutations in C2cd2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00472:C2cd2l APN 9 44,228,400 (GRCm39) missense probably damaging 1.00
IGL01304:C2cd2l APN 9 44,230,884 (GRCm39) missense probably damaging 0.96
IGL02402:C2cd2l APN 9 44,227,878 (GRCm39) missense probably benign 0.31
R0701:C2cd2l UTSW 9 44,227,499 (GRCm39) missense probably damaging 1.00
R0883:C2cd2l UTSW 9 44,227,499 (GRCm39) missense probably damaging 1.00
R1321:C2cd2l UTSW 9 44,228,878 (GRCm39) critical splice donor site probably null
R1594:C2cd2l UTSW 9 44,228,070 (GRCm39) missense probably damaging 1.00
R1665:C2cd2l UTSW 9 44,228,072 (GRCm39) missense probably benign 0.07
R1739:C2cd2l UTSW 9 44,231,040 (GRCm39) missense probably benign 0.26
R1770:C2cd2l UTSW 9 44,228,108 (GRCm39) missense probably benign 0.02
R2065:C2cd2l UTSW 9 44,227,632 (GRCm39) missense probably benign 0.19
R4669:C2cd2l UTSW 9 44,226,322 (GRCm39) missense possibly damaging 0.92
R4835:C2cd2l UTSW 9 44,226,442 (GRCm39) critical splice donor site probably null
R4890:C2cd2l UTSW 9 44,222,430 (GRCm39) missense probably damaging 1.00
R4916:C2cd2l UTSW 9 44,227,857 (GRCm39) missense probably damaging 0.97
R5664:C2cd2l UTSW 9 44,225,069 (GRCm39) missense probably damaging 1.00
R6268:C2cd2l UTSW 9 44,228,963 (GRCm39) missense probably damaging 1.00
R6339:C2cd2l UTSW 9 44,224,788 (GRCm39) splice site probably benign
R7043:C2cd2l UTSW 9 44,227,848 (GRCm39) missense probably damaging 1.00
R7236:C2cd2l UTSW 9 44,228,960 (GRCm39) missense possibly damaging 0.71
R7532:C2cd2l UTSW 9 44,226,681 (GRCm39) missense probably benign 0.41
R8239:C2cd2l UTSW 9 44,227,502 (GRCm39) missense possibly damaging 0.75
R9482:C2cd2l UTSW 9 44,227,914 (GRCm39) missense probably damaging 1.00
R9557:C2cd2l UTSW 9 44,231,127 (GRCm39) missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AGATGCTCGAAGCTGCCGTAAG -3'
(R):5'- TCAGCCTGGAGGAAATCCCTGATG -3'

Sequencing Primer
(F):5'- TCGAAGCTGCCGTAAGAATAATC -3'
(R):5'- GAAATCCCTGATGAGGGGC -3'
Posted On 2014-05-14