Incidental Mutation 'R1700:Gclc'
ID189666
Institutional Source Beutler Lab
Gene Symbol Gclc
Ensembl Gene ENSMUSG00000032350
Gene Nameglutamate-cysteine ligase, catalytic subunit
SynonymsD9Wsu168e, gamma GCS-HS, GLCL-H, Glclc
MMRRC Submission 039733-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1700 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location77754535-77794485 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 77776289 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 143 (T143A)
Ref Sequence ENSEMBL: ENSMUSP00000034905 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034905]
Predicted Effect probably benign
Transcript: ENSMUST00000034905
AA Change: T143A

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000034905
Gene: ENSMUSG00000032350
AA Change: T143A

DomainStartEndE-ValueType
Pfam:GCS 236 608 1.3e-185 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216315
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216848
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Glutamate-cysteine ligase, also known as gamma-glutamylcysteine synthetase is the first rate-limiting enzyme of glutathione synthesis. The enzyme consists of two subunits, a heavy catalytic subunit and a light regulatory subunit. This locus encodes the catalytic subunit, while the regulatory subunit is derived from a different gene located on chromosome 1p22-p21. Mutations at this locus have been associated with hemolytic anemia due to deficiency of gamma-glutamylcysteine synthetase and susceptibility to myocardial infarction.[provided by RefSeq, Oct 2010]
PHENOTYPE: Homozygous mutant mice are embryonic lethal. One model shows lethality before E13 while another shows lethality between E7.5-E8.5. In this second model, embryos are arrested at the egg cylinder stage, fail to gastrulate, do not form mesoderm, and exhibitincreased apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik G A 2: 130,709,938 L1010F probably damaging Het
Abcb1b T C 5: 8,849,537 F936L probably benign Het
Adamts12 T A 15: 11,152,057 I211N probably benign Het
Adamts16 G A 13: 70,779,518 probably benign Het
Alas1 C T 9: 106,239,646 V293I possibly damaging Het
Ap1g1 T C 8: 109,853,612 Y569H probably damaging Het
Apc2 A G 10: 80,312,769 D1190G probably damaging Het
Astn2 G A 4: 65,746,354 Q679* probably null Het
Atp2a1 T A 7: 126,462,909 H5L probably damaging Het
Baiap3 T C 17: 25,249,328 K279E probably damaging Het
C2cd2l G A 9: 44,316,612 P111S probably benign Het
C7 T A 15: 5,002,792 K646* probably null Het
Ccp110 C T 7: 118,735,313 T1003I probably damaging Het
Cdh22 T C 2: 165,170,796 D123G probably damaging Het
Cep295 C T 9: 15,340,883 E397K probably damaging Het
Clip1 A G 5: 123,630,370 V722A probably benign Het
Cpsf4l A G 11: 113,702,075 F174S probably benign Het
Ctnna3 T C 10: 63,852,772 C332R probably damaging Het
Cxcl10 A T 5: 92,347,855 N76K probably damaging Het
Dnaja3 G A 16: 4,684,165 R11K probably null Het
Efcab10 A G 12: 33,395,171 T28A possibly damaging Het
Esrrg A G 1: 188,043,653 R103G probably damaging Het
Exosc2 A G 2: 31,670,806 K23E probably benign Het
Flot2 C T 11: 78,049,547 S40L possibly damaging Het
Fsip2 T C 2: 82,991,737 V5938A probably benign Het
Gpr37 A G 6: 25,669,624 V407A probably benign Het
Gucy2e A T 11: 69,232,058 M497K probably benign Het
Herc1 T A 9: 66,450,678 probably null Het
Hnrnpll A C 17: 80,034,105 S502A probably benign Het
Ipo11 G T 13: 106,795,662 T975N probably benign Het
Kif17 C T 4: 138,262,698 Q66* probably null Het
Lrp10 T C 14: 54,469,752 V682A possibly damaging Het
Lsmem1 A T 12: 40,180,678 L75Q probably damaging Het
Med16 A T 10: 79,899,335 Y430N probably benign Het
Med8 C T 4: 118,412,734 S72L possibly damaging Het
Mex3a A G 3: 88,536,375 T253A probably damaging Het
Myf6 T C 10: 107,493,359 K242E probably damaging Het
Ncald T A 15: 37,397,343 Y31F probably benign Het
Ndufa12 T A 10: 94,199,993 Y48N probably damaging Het
Olfr1111 T G 2: 87,149,779 N294T probably damaging Het
Olfr1145 T C 2: 87,810,768 V316A probably benign Het
Olfr638 T A 7: 104,004,122 Y282* probably null Het
Pde4dip T C 3: 97,703,323 T1858A probably benign Het
Pgbd1 A G 13: 21,434,481 L2P probably damaging Het
Piezo1 C T 8: 122,487,502 R1642H probably damaging Het
Plxna1 A T 6: 89,357,008 M213K probably damaging Het
Polr1b A G 2: 129,123,121 N709S probably damaging Het
Pramel1 T A 4: 143,398,429 W308R probably damaging Het
Prkag2 A T 5: 24,871,541 I208N probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rngtt T A 4: 33,330,864 F156I probably damaging Het
Rpusd3 A G 6: 113,415,533 *345Q probably null Het
Rrp1b A G 17: 32,057,204 K575R probably benign Het
Shd G A 17: 55,974,307 V250I probably damaging Het
Slc12a5 C A 2: 164,992,376 N749K possibly damaging Het
Sorbs2 T A 8: 45,800,984 V488D probably damaging Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Srsf4 C A 4: 131,900,560 probably benign Het
Strn T C 17: 78,692,402 Y135C probably damaging Het
Synm T C 7: 67,759,628 M1V probably null Het
Tas1r3 T G 4: 155,861,570 Q489P probably benign Het
Tas2r103 A T 6: 133,036,811 N97K probably damaging Het
Tas2r113 A G 6: 132,893,792 Y261C possibly damaging Het
Tex21 T C 12: 76,221,672 E112G probably damaging Het
Trappc8 T C 18: 20,832,998 S1128G probably damaging Het
Ubap1l A G 9: 65,371,743 probably benign Het
Ubash3a A G 17: 31,215,044 D121G probably damaging Het
Ubxn4 A G 1: 128,252,286 I56V possibly damaging Het
Uri1 T C 7: 37,963,524 I348M probably damaging Het
Usp21 C A 1: 171,283,722 L379F probably damaging Het
Vmn1r159 T A 7: 22,842,965 H214L probably damaging Het
Zdbf2 A G 1: 63,302,741 E93G unknown Het
Other mutations in Gclc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02026:Gclc APN 9 77792060 missense probably benign
IGL02059:Gclc APN 9 77787816 missense probably damaging 1.00
R0671:Gclc UTSW 9 77786798 missense probably damaging 1.00
R1469:Gclc UTSW 9 77781137 missense probably benign 0.01
R1469:Gclc UTSW 9 77781137 missense probably benign 0.01
R3120:Gclc UTSW 9 77781270 missense possibly damaging 0.84
R3830:Gclc UTSW 9 77791960 missense probably benign 0.24
R6747:Gclc UTSW 9 77788245 missense probably damaging 0.96
R7028:Gclc UTSW 9 77788216 missense probably damaging 1.00
R7120:Gclc UTSW 9 77786750 missense probably damaging 1.00
R7242:Gclc UTSW 9 77785371 missense probably benign 0.00
R7329:Gclc UTSW 9 77776191 missense probably damaging 1.00
R7716:Gclc UTSW 9 77754927 missense probably damaging 1.00
X0021:Gclc UTSW 9 77788209 missense probably damaging 1.00
Z1088:Gclc UTSW 9 77781367 splice site probably null
Z1177:Gclc UTSW 9 77786739 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CTTACAGCCTGTTAGGCTCAGTTCC -3'
(R):5'- GCAGCCCTACAGCAAGAGTGTATC -3'

Sequencing Primer
(F):5'- CACTTAGCAGTCCTAAGGAGTTG -3'
(R):5'- aggcaaatccaacccacag -3'
Posted On2014-05-14