Mutagenetix > Incidental Mutations

Incidental Mutation 'R1700:Alas1'

189667

Institutional Source

Beutler Lab

Gene Symbol

Alas1

Ensembl Gene

ENSMUSG00000032786

Gene Name

aminolevulinic acid synthase 1

Synonyms

succinyl-CoA: glycine C-succinyl transferase, Alas-1, ALAS-N, 5-aminolevulinate synthase

MMRRC Submission

039733-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1700 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

106233455-106248654 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 106239646 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 293 (V293I)

Ref Sequence

ENSEMBL: ENSMUSP00000117014 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074082] [ENSMUST00000112524] [ENSMUST00000133617] [ENSMUST00000141118] [ENSMUST00000143125] [ENSMUST00000214989] [ENSMUST00000215222] [ENSMUST00000219129]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000074082
AA Change: V293I

PolyPhen 2 Score 0.458 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000073725
Gene: ENSMUSG00000032786
AA Change: V293I

Domain	Start	End	E-Value	Type
Pfam:Preseq_ALAS	1	81	1.1e-21	PFAM
Pfam:Preseq_ALAS	73	141	2.8e-12	PFAM
Pfam:Aminotran_1_2	245	591	2.1e-77	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000112524
AA Change: V293I

PolyPhen 2 Score 0.458 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000108143
Gene: ENSMUSG00000032786
AA Change: V293I

Domain	Start	End	E-Value	Type
Pfam:Preseq_ALAS	2	140	1.3e-49	PFAM
Pfam:Aminotran_1_2	245	592	5.3e-80	PFAM
Pfam:Cys_Met_Meta_PP	283	423	1.5e-6	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123115

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123601

Predicted Effect

probably benign
Transcript: ENSMUST00000133617

SMART Domains

Protein: ENSMUSP00000122117
Gene: ENSMUSG00000032786

Domain	Start	End	E-Value	Type
Pfam:Preseq_ALAS	1	79	3.1e-22	PFAM
Pfam:Preseq_ALAS	73	141	8.7e-13	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134053

Predicted Effect

possibly damaging
Transcript: ENSMUST00000141118
AA Change: V293I

PolyPhen 2 Score 0.458 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000117014
Gene: ENSMUSG00000032786
AA Change: V293I

Domain	Start	End	E-Value	Type
Pfam:Preseq_ALAS	1	81	1.7e-20	PFAM
Pfam:Preseq_ALAS	73	141	4.2e-11	PFAM
Pfam:Aminotran_1_2	245	592	5.3e-80	PFAM
Pfam:Aminotran_5	257	422	3.4e-6	PFAM
Pfam:Cys_Met_Meta_PP	285	423	1.8e-6	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000143125

SMART Domains

Protein: ENSMUSP00000119968
Gene: ENSMUSG00000032786

Domain	Start	End	E-Value	Type
Pfam:Aminotran_5	1	61	7.7e-7	PFAM
Pfam:Aminotran_1_2	1	93	2.2e-17	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000214249

Predicted Effect

probably benign
Transcript: ENSMUST00000214989

Predicted Effect

probably benign
Transcript: ENSMUST00000215222

Predicted Effect

probably benign
Transcript: ENSMUST00000219129

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219340

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.4%
20x: 92.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the mitochondrial enzyme which is catalyzes the rate-limiting step in heme (iron-protoporphyrin) biosynthesis. The enzyme encoded by this gene is the housekeeping enzyme; a separate gene encodes a form of the enzyme that is specific for erythroid tissue. The level of the mature encoded protein is regulated by heme: high levels of heme down-regulate the mature enzyme in mitochondria while low heme levels up-regulate. A pseudogene of this gene is located on chromosome 12. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a reporter allele exhibit embryonic lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930402H24Rik	G	A	2: 130,709,938	L1010F	probably damaging	Het
Abcb1b	T	C	5: 8,849,537	F936L	probably benign	Het
Adamts12	T	A	15: 11,152,057	I211N	probably benign	Het
Adamts16	G	A	13: 70,779,518		probably benign	Het
Ap1g1	T	C	8: 109,853,612	Y569H	probably damaging	Het
Apc2	A	G	10: 80,312,769	D1190G	probably damaging	Het
Astn2	G	A	4: 65,746,354	Q679*	probably null	Het
Atp2a1	T	A	7: 126,462,909	H5L	probably damaging	Het
Baiap3	T	C	17: 25,249,328	K279E	probably damaging	Het
C2cd2l	G	A	9: 44,316,612	P111S	probably benign	Het
C7	T	A	15: 5,002,792	K646*	probably null	Het
Ccp110	C	T	7: 118,735,313	T1003I	probably damaging	Het
Cdh22	T	C	2: 165,170,796	D123G	probably damaging	Het
Cep295	C	T	9: 15,340,883	E397K	probably damaging	Het
Clip1	A	G	5: 123,630,370	V722A	probably benign	Het
Cpsf4l	A	G	11: 113,702,075	F174S	probably benign	Het
Ctnna3	T	C	10: 63,852,772	C332R	probably damaging	Het
Cxcl10	A	T	5: 92,347,855	N76K	probably damaging	Het
Dnaja3	G	A	16: 4,684,165	R11K	probably null	Het
Efcab10	A	G	12: 33,395,171	T28A	possibly damaging	Het
Esrrg	A	G	1: 188,043,653	R103G	probably damaging	Het
Exosc2	A	G	2: 31,670,806	K23E	probably benign	Het
Flot2	C	T	11: 78,049,547	S40L	possibly damaging	Het
Fsip2	T	C	2: 82,991,737	V5938A	probably benign	Het
Gclc	A	G	9: 77,776,289	T143A	probably benign	Het
Gpr37	A	G	6: 25,669,624	V407A	probably benign	Het
Gucy2e	A	T	11: 69,232,058	M497K	probably benign	Het
Herc1	T	A	9: 66,450,678		probably null	Het
Hnrnpll	A	C	17: 80,034,105	S502A	probably benign	Het
Ipo11	G	T	13: 106,795,662	T975N	probably benign	Het
Kif17	C	T	4: 138,262,698	Q66*	probably null	Het
Lrp10	T	C	14: 54,469,752	V682A	possibly damaging	Het
Lsmem1	A	T	12: 40,180,678	L75Q	probably damaging	Het
Med16	A	T	10: 79,899,335	Y430N	probably benign	Het
Med8	C	T	4: 118,412,734	S72L	possibly damaging	Het
Mex3a	A	G	3: 88,536,375	T253A	probably damaging	Het
Myf6	T	C	10: 107,493,359	K242E	probably damaging	Het
Ncald	T	A	15: 37,397,343	Y31F	probably benign	Het
Ndufa12	T	A	10: 94,199,993	Y48N	probably damaging	Het
Olfr1111	T	G	2: 87,149,779	N294T	probably damaging	Het
Olfr1145	T	C	2: 87,810,768	V316A	probably benign	Het
Olfr638	T	A	7: 104,004,122	Y282*	probably null	Het
Pde4dip	T	C	3: 97,703,323	T1858A	probably benign	Het
Pgbd1	A	G	13: 21,434,481	L2P	probably damaging	Het
Piezo1	C	T	8: 122,487,502	R1642H	probably damaging	Het
Plxna1	A	T	6: 89,357,008	M213K	probably damaging	Het
Polr1b	A	G	2: 129,123,121	N709S	probably damaging	Het
Pramel1	T	A	4: 143,398,429	W308R	probably damaging	Het
Prkag2	A	T	5: 24,871,541	I208N	probably damaging	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Rngtt	T	A	4: 33,330,864	F156I	probably damaging	Het
Rpusd3	A	G	6: 113,415,533	*345Q	probably null	Het
Rrp1b	A	G	17: 32,057,204	K575R	probably benign	Het
Shd	G	A	17: 55,974,307	V250I	probably damaging	Het
Slc12a5	C	A	2: 164,992,376	N749K	possibly damaging	Het
Sorbs2	T	A	8: 45,800,984	V488D	probably damaging	Het
Sphkap	G	A	1: 83,277,515	R838*	probably null	Het
Srsf4	C	A	4: 131,900,560		probably benign	Het
Strn	T	C	17: 78,692,402	Y135C	probably damaging	Het
Synm	T	C	7: 67,759,628	M1V	probably null	Het
Tas1r3	T	G	4: 155,861,570	Q489P	probably benign	Het
Tas2r103	A	T	6: 133,036,811	N97K	probably damaging	Het
Tas2r113	A	G	6: 132,893,792	Y261C	possibly damaging	Het
Tex21	T	C	12: 76,221,672	E112G	probably damaging	Het
Trappc8	T	C	18: 20,832,998	S1128G	probably damaging	Het
Ubap1l	A	G	9: 65,371,743		probably benign	Het
Ubash3a	A	G	17: 31,215,044	D121G	probably damaging	Het
Ubxn4	A	G	1: 128,252,286	I56V	possibly damaging	Het
Uri1	T	C	7: 37,963,524	I348M	probably damaging	Het
Usp21	C	A	1: 171,283,722	L379F	probably damaging	Het
Vmn1r159	T	A	7: 22,842,965	H214L	probably damaging	Het
Zdbf2	A	G	1: 63,302,741	E93G	unknown	Het

Other mutations in Alas1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00911:Alas1	APN	9	106236472	missense	probably benign	0.17
IGL02165:Alas1	APN	9	106238783	missense	probably damaging	1.00
IGL02355:Alas1	APN	9	106236639	missense	probably damaging	1.00
IGL02362:Alas1	APN	9	106236639	missense	probably damaging	1.00
IGL02499:Alas1	APN	9	106241321	missense	probably damaging	1.00
IGL02606:Alas1	APN	9	106241110	unclassified	probably benign
IGL03121:Alas1	APN	9	106246914	missense	probably damaging	0.99
R0115:Alas1	UTSW	9	106238252	splice site	probably null
R0294:Alas1	UTSW	9	106241256	missense	probably damaging	1.00
R0333:Alas1	UTSW	9	106241281	missense	probably benign	0.08
R0346:Alas1	UTSW	9	106243351	missense	possibly damaging	0.78
R1982:Alas1	UTSW	9	106238185	missense	probably damaging	1.00
R2056:Alas1	UTSW	9	106241290	missense	probably damaging	1.00
R2058:Alas1	UTSW	9	106241290	missense	probably damaging	1.00
R2059:Alas1	UTSW	9	106241290	missense	probably damaging	1.00
R2355:Alas1	UTSW	9	106236474	missense	probably damaging	0.96
R2516:Alas1	UTSW	9	106238660	missense	probably damaging	1.00
R3896:Alas1	UTSW	9	106241801	intron	probably null
R4091:Alas1	UTSW	9	106241801	intron	probably null
R4093:Alas1	UTSW	9	106241801	intron	probably null
R4095:Alas1	UTSW	9	106241801	intron	probably null
R4673:Alas1	UTSW	9	106236477	missense	probably damaging	1.00
R4948:Alas1	UTSW	9	106246878	nonsense	probably null
R5165:Alas1	UTSW	9	106241255	missense	probably damaging	1.00
R5215:Alas1	UTSW	9	106243375	missense	probably benign	0.05
R5420:Alas1	UTSW	9	106234159	missense	probably benign	0.13
R5993:Alas1	UTSW	9	106234129	missense	probably benign	0.11
R6033:Alas1	UTSW	9	106241204	missense	probably damaging	1.00
R6033:Alas1	UTSW	9	106241204	missense	probably damaging	1.00
R7489:Alas1	UTSW	9	106241634	critical splice donor site	probably null
R7726:Alas1	UTSW	9	106246951	missense	probably benign	0.00
R8012:Alas1	UTSW	9	106246763	missense	probably benign
R8036:Alas1	UTSW	9	106235522	missense	probably benign	0.19
Z1176:Alas1	UTSW	9	106238769	missense	probably benign	0.42
Z1176:Alas1	UTSW	9	106243367	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TGCTCAAGACGACGCTCTGACAC -3'
(R):5'- TTGACACTCACTCTGGCCCAGTGC -3'

Sequencing Primer
(F):5'- AGTGGGCCTTCTTTGTAGACAC -3'
(R):5'- AGTGCTGGGGTTGTAAAAATG -3'

Posted On

2014-05-14