Incidental Mutation 'R1700:Cpsf4l'
ID 189676
Institutional Source Beutler Lab
Gene Symbol Cpsf4l
Ensembl Gene ENSMUSG00000018727
Gene Name cleavage and polyadenylation specific factor 4-like
Synonyms 1500000C01Rik, D11Ertd636e, 0610010C04Rik
MMRRC Submission 039733-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.076) question?
Stock # R1700 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 113588998-113600843 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 113592901 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 174 (F174S)
Ref Sequence ENSEMBL: ENSMUSP00000133451 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018871] [ENSMUST00000100248] [ENSMUST00000106617] [ENSMUST00000173655]
AlphaFold E9Q2N0
Predicted Effect probably benign
Transcript: ENSMUST00000018871
SMART Domains Protein: ENSMUSP00000018871
Gene: ENSMUSG00000018727

DomainStartEndE-ValueType
ZnF_C3H1 10 36 1.1e-2 SMART
ZnF_C3H1 38 64 4.64e-1 SMART
ZnF_C3H1 68 93 2.34e0 SMART
ZnF_C3H1 94 117 2.4e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100248
AA Change: F226S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000097819
Gene: ENSMUSG00000018727
AA Change: F226S

DomainStartEndE-ValueType
low complexity region 62 74 N/A INTRINSIC
ZnF_C3H1 89 114 3.38e-1 SMART
ZnF_C3H1 115 141 1.1e-2 SMART
ZnF_C3H1 143 169 4.64e-1 SMART
ZnF_C3H1 173 197 1.36e-2 SMART
ZnF_C3H1 198 221 5.21e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106617
AA Change: F122S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000102228
Gene: ENSMUSG00000018727
AA Change: F122S

DomainStartEndE-ValueType
ZnF_C3H1 10 36 1.1e-2 SMART
ZnF_C3H1 38 64 4.64e-1 SMART
ZnF_C3H1 68 93 2.34e0 SMART
ZnF_C3H1 94 117 5.21e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151396
Predicted Effect probably benign
Transcript: ENSMUST00000173655
AA Change: F174S

PolyPhen 2 Score 0.169 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000133451
Gene: ENSMUSG00000018727
AA Change: F174S

DomainStartEndE-ValueType
ZnF_C3H1 35 61 1.33e-1 SMART
ZnF_C3H1 62 88 1.1e-2 SMART
ZnF_C3H1 90 116 4.64e-1 SMART
ZnF_C3H1 120 145 2.34e0 SMART
ZnF_C3H1 146 169 5.21e-1 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T C 5: 8,899,537 (GRCm39) F936L probably benign Het
Adamts12 T A 15: 11,152,143 (GRCm39) I211N probably benign Het
Adamts16 G A 13: 70,927,637 (GRCm39) probably benign Het
Alas1 C T 9: 106,116,845 (GRCm39) V293I possibly damaging Het
Ap1g1 T C 8: 110,580,244 (GRCm39) Y569H probably damaging Het
Apc2 A G 10: 80,148,603 (GRCm39) D1190G probably damaging Het
Astn2 G A 4: 65,664,591 (GRCm39) Q679* probably null Het
Atp2a1 T A 7: 126,062,081 (GRCm39) H5L probably damaging Het
Baiap3 T C 17: 25,468,302 (GRCm39) K279E probably damaging Het
C2cd2l G A 9: 44,227,909 (GRCm39) P111S probably benign Het
C7 T A 15: 5,032,274 (GRCm39) K646* probably null Het
Ccp110 C T 7: 118,334,536 (GRCm39) T1003I probably damaging Het
Cdh22 T C 2: 165,012,716 (GRCm39) D123G probably damaging Het
Cep295 C T 9: 15,252,179 (GRCm39) E397K probably damaging Het
Clip1 A G 5: 123,768,433 (GRCm39) V722A probably benign Het
Ctnna3 T C 10: 63,688,551 (GRCm39) C332R probably damaging Het
Cxcl10 A T 5: 92,495,714 (GRCm39) N76K probably damaging Het
Dnaaf9 G A 2: 130,551,858 (GRCm39) L1010F probably damaging Het
Dnaja3 G A 16: 4,502,029 (GRCm39) R11K probably null Het
Efcab10 A G 12: 33,445,170 (GRCm39) T28A possibly damaging Het
Esrrg A G 1: 187,775,850 (GRCm39) R103G probably damaging Het
Exosc2 A G 2: 31,560,818 (GRCm39) K23E probably benign Het
Flot2 C T 11: 77,940,373 (GRCm39) S40L possibly damaging Het
Fsip2 T C 2: 82,822,081 (GRCm39) V5938A probably benign Het
Gclc A G 9: 77,683,571 (GRCm39) T143A probably benign Het
Gpr37 A G 6: 25,669,623 (GRCm39) V407A probably benign Het
Gucy2e A T 11: 69,122,884 (GRCm39) M497K probably benign Het
Herc1 T A 9: 66,357,960 (GRCm39) probably null Het
Hnrnpll A C 17: 80,341,534 (GRCm39) S502A probably benign Het
Ipo11 G T 13: 106,932,170 (GRCm39) T975N probably benign Het
Kif17 C T 4: 137,990,009 (GRCm39) Q66* probably null Het
Lrp10 T C 14: 54,707,209 (GRCm39) V682A possibly damaging Het
Lsmem1 A T 12: 40,230,677 (GRCm39) L75Q probably damaging Het
Med16 A T 10: 79,735,169 (GRCm39) Y430N probably benign Het
Med8 C T 4: 118,269,931 (GRCm39) S72L possibly damaging Het
Mex3a A G 3: 88,443,682 (GRCm39) T253A probably damaging Het
Myf6 T C 10: 107,329,220 (GRCm39) K242E probably damaging Het
Ncald T A 15: 37,397,587 (GRCm39) Y31F probably benign Het
Ndufa12 T A 10: 94,035,855 (GRCm39) Y48N probably damaging Het
Or12e10 T C 2: 87,641,112 (GRCm39) V316A probably benign Het
Or51q1c T A 7: 103,653,329 (GRCm39) Y282* probably null Het
Or5as1 T G 2: 86,980,123 (GRCm39) N294T probably damaging Het
Pde4dip T C 3: 97,610,639 (GRCm39) T1858A probably benign Het
Pgbd1 A G 13: 21,618,651 (GRCm39) L2P probably damaging Het
Piezo1 C T 8: 123,214,241 (GRCm39) R1642H probably damaging Het
Plxna1 A T 6: 89,333,990 (GRCm39) M213K probably damaging Het
Polr1b A G 2: 128,965,041 (GRCm39) N709S probably damaging Het
Pramel1 T A 4: 143,124,999 (GRCm39) W308R probably damaging Het
Prkag2 A T 5: 25,076,539 (GRCm39) I208N probably damaging Het
Ptpro T A 6: 137,420,592 (GRCm39) V1007D probably damaging Het
Rngtt T A 4: 33,330,864 (GRCm39) F156I probably damaging Het
Rpusd3 A G 6: 113,392,494 (GRCm39) *345Q probably null Het
Rrp1b A G 17: 32,276,178 (GRCm39) K575R probably benign Het
Shd G A 17: 56,281,307 (GRCm39) V250I probably damaging Het
Slc12a5 C A 2: 164,834,296 (GRCm39) N749K possibly damaging Het
Sorbs2 T A 8: 46,254,021 (GRCm39) V488D probably damaging Het
Sphkap G A 1: 83,255,236 (GRCm39) R838* probably null Het
Srsf4 C A 4: 131,627,871 (GRCm39) probably benign Het
Strn T C 17: 78,999,831 (GRCm39) Y135C probably damaging Het
Synm T C 7: 67,409,376 (GRCm39) M1V probably null Het
Tas1r3 T G 4: 155,946,027 (GRCm39) Q489P probably benign Het
Tas2r103 A T 6: 133,013,774 (GRCm39) N97K probably damaging Het
Tas2r113 A G 6: 132,870,755 (GRCm39) Y261C possibly damaging Het
Tex21 T C 12: 76,268,446 (GRCm39) E112G probably damaging Het
Trappc8 T C 18: 20,966,055 (GRCm39) S1128G probably damaging Het
Ubap1l A G 9: 65,279,025 (GRCm39) probably benign Het
Ubash3a A G 17: 31,434,018 (GRCm39) D121G probably damaging Het
Ubxn4 A G 1: 128,180,023 (GRCm39) I56V possibly damaging Het
Uri1 T C 7: 37,662,949 (GRCm39) I348M probably damaging Het
Usp21 C A 1: 171,111,295 (GRCm39) L379F probably damaging Het
Vmn1r159 T A 7: 22,542,390 (GRCm39) H214L probably damaging Het
Zdbf2 A G 1: 63,341,900 (GRCm39) E93G unknown Het
Other mutations in Cpsf4l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Cpsf4l APN 11 113,600,044 (GRCm39) intron probably benign
IGL02132:Cpsf4l APN 11 113,590,685 (GRCm39) missense possibly damaging 0.84
IGL02427:Cpsf4l APN 11 113,600,324 (GRCm39) utr 5 prime probably benign
R0790:Cpsf4l UTSW 11 113,597,234 (GRCm39) splice site probably benign
R1909:Cpsf4l UTSW 11 113,594,204 (GRCm39) splice site probably null
R3522:Cpsf4l UTSW 11 113,593,319 (GRCm39) missense probably damaging 1.00
R4830:Cpsf4l UTSW 11 113,600,328 (GRCm39) utr 5 prime probably benign
R6006:Cpsf4l UTSW 11 113,590,753 (GRCm39) missense probably benign 0.23
R6229:Cpsf4l UTSW 11 113,599,680 (GRCm39) missense possibly damaging 0.89
R6593:Cpsf4l UTSW 11 113,600,192 (GRCm39) intron probably benign
R7107:Cpsf4l UTSW 11 113,593,315 (GRCm39) missense possibly damaging 0.55
R7373:Cpsf4l UTSW 11 113,590,657 (GRCm39) splice site probably null
R8517:Cpsf4l UTSW 11 113,599,651 (GRCm39) missense probably benign 0.02
R8733:Cpsf4l UTSW 11 113,600,279 (GRCm39) missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- AGAAAGAAAGCATCCCCGTGTTACC -3'
(R):5'- TGACATGATGTGATTCCCTTTGCCC -3'

Sequencing Primer
(F):5'- GTGCAGACATCATGGGCTG -3'
(R):5'- tgggtcctgttggctgag -3'
Posted On 2014-05-14