Incidental Mutation 'R1700:Strn'
ID 189693
Institutional Source Beutler Lab
Gene Symbol Strn
Ensembl Gene ENSMUSG00000024077
Gene Name striatin, calmodulin binding protein
MMRRC Submission 039733-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.522) question?
Stock # R1700 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 78649913-78737196 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 78692402 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 135 (Y135C)
Ref Sequence ENSEMBL: ENSMUSP00000120830 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024881] [ENSMUST00000145910]
AlphaFold O55106
Predicted Effect probably benign
Transcript: ENSMUST00000024881
SMART Domains Protein: ENSMUSP00000024881
Gene: ENSMUSG00000024077

low complexity region 85 101 N/A INTRINSIC
low complexity region 178 195 N/A INTRINSIC
low complexity region 223 231 N/A INTRINSIC
low complexity region 259 276 N/A INTRINSIC
WD40 299 338 6.04e-8 SMART
WD40 352 391 2.42e-7 SMART
WD40 405 444 1.21e-7 SMART
WD40 493 539 1.28e1 SMART
WD40 542 581 4.4e-10 SMART
WD40 584 627 2.48e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000145910
AA Change: Y135C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120830
Gene: ENSMUSG00000024077
AA Change: Y135C

low complexity region 17 45 N/A INTRINSIC
Pfam:Striatin 48 177 4.2e-50 PFAM
low complexity region 238 254 N/A INTRINSIC
low complexity region 331 348 N/A INTRINSIC
low complexity region 376 384 N/A INTRINSIC
low complexity region 412 429 N/A INTRINSIC
WD40 452 491 6.04e-8 SMART
WD40 505 544 2.42e-7 SMART
WD40 558 597 1.21e-7 SMART
WD40 646 692 1.28e1 SMART
WD40 695 734 4.4e-10 SMART
WD40 737 780 2.48e-4 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice heterozygous for a knock-out allele exhibit increased blood pressure and circulating aldosterone when fed a liberal salt diet. No mice could be generated that were homozygous for the allele. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik G A 2: 130,709,938 L1010F probably damaging Het
Abcb1b T C 5: 8,849,537 F936L probably benign Het
Adamts12 T A 15: 11,152,057 I211N probably benign Het
Adamts16 G A 13: 70,779,518 probably benign Het
Alas1 C T 9: 106,239,646 V293I possibly damaging Het
Ap1g1 T C 8: 109,853,612 Y569H probably damaging Het
Apc2 A G 10: 80,312,769 D1190G probably damaging Het
Astn2 G A 4: 65,746,354 Q679* probably null Het
Atp2a1 T A 7: 126,462,909 H5L probably damaging Het
Baiap3 T C 17: 25,249,328 K279E probably damaging Het
C2cd2l G A 9: 44,316,612 P111S probably benign Het
C7 T A 15: 5,002,792 K646* probably null Het
Ccp110 C T 7: 118,735,313 T1003I probably damaging Het
Cdh22 T C 2: 165,170,796 D123G probably damaging Het
Cep295 C T 9: 15,340,883 E397K probably damaging Het
Clip1 A G 5: 123,630,370 V722A probably benign Het
Cpsf4l A G 11: 113,702,075 F174S probably benign Het
Ctnna3 T C 10: 63,852,772 C332R probably damaging Het
Cxcl10 A T 5: 92,347,855 N76K probably damaging Het
Dnaja3 G A 16: 4,684,165 R11K probably null Het
Efcab10 A G 12: 33,395,171 T28A possibly damaging Het
Esrrg A G 1: 188,043,653 R103G probably damaging Het
Exosc2 A G 2: 31,670,806 K23E probably benign Het
Flot2 C T 11: 78,049,547 S40L possibly damaging Het
Fsip2 T C 2: 82,991,737 V5938A probably benign Het
Gclc A G 9: 77,776,289 T143A probably benign Het
Gpr37 A G 6: 25,669,624 V407A probably benign Het
Gucy2e A T 11: 69,232,058 M497K probably benign Het
Herc1 T A 9: 66,450,678 probably null Het
Hnrnpll A C 17: 80,034,105 S502A probably benign Het
Ipo11 G T 13: 106,795,662 T975N probably benign Het
Kif17 C T 4: 138,262,698 Q66* probably null Het
Lrp10 T C 14: 54,469,752 V682A possibly damaging Het
Lsmem1 A T 12: 40,180,678 L75Q probably damaging Het
Med16 A T 10: 79,899,335 Y430N probably benign Het
Med8 C T 4: 118,412,734 S72L possibly damaging Het
Mex3a A G 3: 88,536,375 T253A probably damaging Het
Myf6 T C 10: 107,493,359 K242E probably damaging Het
Ncald T A 15: 37,397,343 Y31F probably benign Het
Ndufa12 T A 10: 94,199,993 Y48N probably damaging Het
Olfr1111 T G 2: 87,149,779 N294T probably damaging Het
Olfr1145 T C 2: 87,810,768 V316A probably benign Het
Olfr638 T A 7: 104,004,122 Y282* probably null Het
Pde4dip T C 3: 97,703,323 T1858A probably benign Het
Pgbd1 A G 13: 21,434,481 L2P probably damaging Het
Piezo1 C T 8: 122,487,502 R1642H probably damaging Het
Plxna1 A T 6: 89,357,008 M213K probably damaging Het
Polr1b A G 2: 129,123,121 N709S probably damaging Het
Pramel1 T A 4: 143,398,429 W308R probably damaging Het
Prkag2 A T 5: 24,871,541 I208N probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rngtt T A 4: 33,330,864 F156I probably damaging Het
Rpusd3 A G 6: 113,415,533 *345Q probably null Het
Rrp1b A G 17: 32,057,204 K575R probably benign Het
Shd G A 17: 55,974,307 V250I probably damaging Het
Slc12a5 C A 2: 164,992,376 N749K possibly damaging Het
Sorbs2 T A 8: 45,800,984 V488D probably damaging Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Srsf4 C A 4: 131,900,560 probably benign Het
Synm T C 7: 67,759,628 M1V probably null Het
Tas1r3 T G 4: 155,861,570 Q489P probably benign Het
Tas2r103 A T 6: 133,036,811 N97K probably damaging Het
Tas2r113 A G 6: 132,893,792 Y261C possibly damaging Het
Tex21 T C 12: 76,221,672 E112G probably damaging Het
Trappc8 T C 18: 20,832,998 S1128G probably damaging Het
Ubap1l A G 9: 65,371,743 probably benign Het
Ubash3a A G 17: 31,215,044 D121G probably damaging Het
Ubxn4 A G 1: 128,252,286 I56V possibly damaging Het
Uri1 T C 7: 37,963,524 I348M probably damaging Het
Usp21 C A 1: 171,283,722 L379F probably damaging Het
Vmn1r159 T A 7: 22,842,965 H214L probably damaging Het
Zdbf2 A G 1: 63,302,741 E93G unknown Het
Other mutations in Strn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00722:Strn APN 17 78692420 missense possibly damaging 0.89
IGL02165:Strn APN 17 78687620 missense probably damaging 1.00
IGL02424:Strn APN 17 78684351 missense probably damaging 1.00
IGL02473:Strn APN 17 78684293 missense possibly damaging 0.71
IGL03306:Strn APN 17 78667223 missense probably damaging 0.98
R0053:Strn UTSW 17 78656934 missense possibly damaging 0.92
R0053:Strn UTSW 17 78656934 missense possibly damaging 0.92
R0165:Strn UTSW 17 78677374 missense possibly damaging 0.89
R1156:Strn UTSW 17 78656931 missense probably damaging 0.99
R1191:Strn UTSW 17 78692426 missense possibly damaging 0.82
R1256:Strn UTSW 17 78664617 critical splice donor site probably null
R1878:Strn UTSW 17 78677326 missense possibly damaging 0.81
R1897:Strn UTSW 17 78682842 missense probably benign 0.01
R1912:Strn UTSW 17 78684395 missense probably damaging 1.00
R1975:Strn UTSW 17 78692499 splice site probably null
R2357:Strn UTSW 17 78655599 missense probably damaging 1.00
R3054:Strn UTSW 17 78682892 missense probably damaging 0.99
R3693:Strn UTSW 17 78656992 missense probably damaging 1.00
R3694:Strn UTSW 17 78656992 missense probably damaging 1.00
R3695:Strn UTSW 17 78656992 missense probably damaging 1.00
R3941:Strn UTSW 17 78657940 missense probably damaging 0.99
R4431:Strn UTSW 17 78736462 missense probably damaging 1.00
R4570:Strn UTSW 17 78677372 missense possibly damaging 0.95
R4678:Strn UTSW 17 78677351 missense probably damaging 1.00
R4729:Strn UTSW 17 78657961 missense probably damaging 0.98
R4947:Strn UTSW 17 78661779 missense probably damaging 0.98
R5470:Strn UTSW 17 78656945 missense probably benign 0.01
R5710:Strn UTSW 17 78687599 missense probably damaging 1.00
R5943:Strn UTSW 17 78669847 missense probably damaging 0.96
R6173:Strn UTSW 17 78700869 missense probably damaging 1.00
R6800:Strn UTSW 17 78670358 intron probably benign
R6846:Strn UTSW 17 78736457 missense probably damaging 0.97
R7716:Strn UTSW 17 78655775 missense probably damaging 0.99
R7746:Strn UTSW 17 78677372 missense probably benign 0.11
R7950:Strn UTSW 17 78670423 missense
R7997:Strn UTSW 17 78684243 missense probably benign 0.01
R8344:Strn UTSW 17 78672647 missense probably damaging 1.00
R9074:Strn UTSW 17 78736361 missense probably benign 0.00
R9523:Strn UTSW 17 78660146 missense probably benign 0.17
R9538:Strn UTSW 17 78664790 missense possibly damaging 0.68
RF006:Strn UTSW 17 78677271 frame shift probably null
RF008:Strn UTSW 17 78677287 frame shift probably null
RF017:Strn UTSW 17 78677288 frame shift probably null
RF018:Strn UTSW 17 78677283 frame shift probably null
RF031:Strn UTSW 17 78677277 frame shift probably null
RF035:Strn UTSW 17 78677285 frame shift probably null
RF036:Strn UTSW 17 78677277 frame shift probably null
RF038:Strn UTSW 17 78677282 frame shift probably null
RF039:Strn UTSW 17 78677278 frame shift probably null
RF044:Strn UTSW 17 78677288 frame shift probably null
RF045:Strn UTSW 17 78677282 frame shift probably null
RF047:Strn UTSW 17 78677270 frame shift probably null
RF047:Strn UTSW 17 78677274 frame shift probably null
RF048:Strn UTSW 17 78677287 frame shift probably null
X0022:Strn UTSW 17 78700949 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- aaaaacaagcccaaaagcaatag -3'
Posted On 2014-05-14