Incidental Mutation 'R1700:Hnrnpll'
ID189694
Institutional Source Beutler Lab
Gene Symbol Hnrnpll
Ensembl Gene ENSMUSG00000024095
Gene Nameheterogeneous nuclear ribonucleoprotein L-like
Synonyms2510028H02Rik, Hnrpll, 2810036L13Rik
MMRRC Submission 039733-MU
Accession Numbers

Genbank: NM_144802; MGI: 1919942

Is this an essential gene? Probably essential (E-score: 0.868) question?
Stock #R1700 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location80029487-80062334 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 80034105 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 502 (S502A)
Ref Sequence ENSEMBL: ENSMUSP00000139372 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061331] [ENSMUST00000184297] [ENSMUST00000184635]
Predicted Effect probably benign
Transcript: ENSMUST00000061331
AA Change: S502A

PolyPhen 2 Score 0.184 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000058308
Gene: ENSMUSG00000024095
AA Change: S502A

DomainStartEndE-ValueType
low complexity region 52 104 N/A INTRINSIC
RRM 126 195 2.99e-4 SMART
RRM 216 289 1.26e-2 SMART
low complexity region 314 325 N/A INTRINSIC
RRM 385 454 1.36e-7 SMART
Blast:RRM_2 504 582 3e-32 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157558
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183516
Predicted Effect probably benign
Transcript: ENSMUST00000184297
SMART Domains Protein: ENSMUSP00000139075
Gene: ENSMUSG00000024095

DomainStartEndE-ValueType
low complexity region 52 104 N/A INTRINSIC
RRM 126 195 2.99e-4 SMART
RRM 216 289 1.26e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184578
Predicted Effect probably benign
Transcript: ENSMUST00000184635
AA Change: S502A

PolyPhen 2 Score 0.184 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000139372
Gene: ENSMUSG00000024095
AA Change: S502A

DomainStartEndE-ValueType
low complexity region 52 104 N/A INTRINSIC
RRM 126 195 2.99e-4 SMART
RRM 216 289 1.26e-2 SMART
low complexity region 314 325 N/A INTRINSIC
RRM 385 454 1.36e-7 SMART
Blast:RRM_2 504 582 3e-32 BLAST
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HNRNPLL is a master regulator of activation-induced alternative splicing in T cells. In particular, it alters splicing of CD45 (PTPRC; MIM 151460), a tyrosine phosphatase essential for T-cell development and activation (Oberdoerffer et al., 2008 [PubMed 18669861]).[supplied by OMIM, Aug 2008]
PHENOTYPE: Mice homozygous for a point mutation in a RNA recognition motif of the gene product have defects in the generation of alternative transcripts normally found in memory T cells. Total CD4+ T cell counts are lower, with a reduction of na�ve CD44lo T cells occurring as mice age. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Gene trapped(5) Chemically induced(1)

Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik G A 2: 130,709,938 L1010F probably damaging Het
Abcb1b T C 5: 8,849,537 F936L probably benign Het
Adamts12 T A 15: 11,152,057 I211N probably benign Het
Adamts16 G A 13: 70,779,518 probably benign Het
Alas1 C T 9: 106,239,646 V293I possibly damaging Het
Ap1g1 T C 8: 109,853,612 Y569H probably damaging Het
Apc2 A G 10: 80,312,769 D1190G probably damaging Het
Astn2 G A 4: 65,746,354 Q679* probably null Het
Atp2a1 T A 7: 126,462,909 H5L probably damaging Het
Baiap3 T C 17: 25,249,328 K279E probably damaging Het
C2cd2l G A 9: 44,316,612 P111S probably benign Het
C7 T A 15: 5,002,792 K646* probably null Het
Ccp110 C T 7: 118,735,313 T1003I probably damaging Het
Cdh22 T C 2: 165,170,796 D123G probably damaging Het
Cep295 C T 9: 15,340,883 E397K probably damaging Het
Clip1 A G 5: 123,630,370 V722A probably benign Het
Cpsf4l A G 11: 113,702,075 F174S probably benign Het
Ctnna3 T C 10: 63,852,772 C332R probably damaging Het
Cxcl10 A T 5: 92,347,855 N76K probably damaging Het
Dnaja3 G A 16: 4,684,165 R11K probably null Het
Efcab10 A G 12: 33,395,171 T28A possibly damaging Het
Esrrg A G 1: 188,043,653 R103G probably damaging Het
Exosc2 A G 2: 31,670,806 K23E probably benign Het
Flot2 C T 11: 78,049,547 S40L possibly damaging Het
Fsip2 T C 2: 82,991,737 V5938A probably benign Het
Gclc A G 9: 77,776,289 T143A probably benign Het
Gpr37 A G 6: 25,669,624 V407A probably benign Het
Gucy2e A T 11: 69,232,058 M497K probably benign Het
Herc1 T A 9: 66,450,678 probably null Het
Ipo11 G T 13: 106,795,662 T975N probably benign Het
Kif17 C T 4: 138,262,698 Q66* probably null Het
Lrp10 T C 14: 54,469,752 V682A possibly damaging Het
Lsmem1 A T 12: 40,180,678 L75Q probably damaging Het
Med16 A T 10: 79,899,335 Y430N probably benign Het
Med8 C T 4: 118,412,734 S72L possibly damaging Het
Mex3a A G 3: 88,536,375 T253A probably damaging Het
Myf6 T C 10: 107,493,359 K242E probably damaging Het
Ncald T A 15: 37,397,343 Y31F probably benign Het
Ndufa12 T A 10: 94,199,993 Y48N probably damaging Het
Olfr1111 T G 2: 87,149,779 N294T probably damaging Het
Olfr1145 T C 2: 87,810,768 V316A probably benign Het
Olfr638 T A 7: 104,004,122 Y282* probably null Het
Pde4dip T C 3: 97,703,323 T1858A probably benign Het
Pgbd1 A G 13: 21,434,481 L2P probably damaging Het
Piezo1 C T 8: 122,487,502 R1642H probably damaging Het
Plxna1 A T 6: 89,357,008 M213K probably damaging Het
Polr1b A G 2: 129,123,121 N709S probably damaging Het
Pramel1 T A 4: 143,398,429 W308R probably damaging Het
Prkag2 A T 5: 24,871,541 I208N probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rngtt T A 4: 33,330,864 F156I probably damaging Het
Rpusd3 A G 6: 113,415,533 *345Q probably null Het
Rrp1b A G 17: 32,057,204 K575R probably benign Het
Shd G A 17: 55,974,307 V250I probably damaging Het
Slc12a5 C A 2: 164,992,376 N749K possibly damaging Het
Sorbs2 T A 8: 45,800,984 V488D probably damaging Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Srsf4 C A 4: 131,900,560 probably benign Het
Strn T C 17: 78,692,402 Y135C probably damaging Het
Synm T C 7: 67,759,628 M1V probably null Het
Tas1r3 T G 4: 155,861,570 Q489P probably benign Het
Tas2r103 A T 6: 133,036,811 N97K probably damaging Het
Tas2r113 A G 6: 132,893,792 Y261C possibly damaging Het
Tex21 T C 12: 76,221,672 E112G probably damaging Het
Trappc8 T C 18: 20,832,998 S1128G probably damaging Het
Ubap1l A G 9: 65,371,743 probably benign Het
Ubash3a A G 17: 31,215,044 D121G probably damaging Het
Ubxn4 A G 1: 128,252,286 I56V possibly damaging Het
Uri1 T C 7: 37,963,524 I348M probably damaging Het
Usp21 C A 1: 171,283,722 L379F probably damaging Het
Vmn1r159 T A 7: 22,842,965 H214L probably damaging Het
Zdbf2 A G 1: 63,302,741 E93G unknown Het
Other mutations in Hnrnpll
AlleleSourceChrCoordTypePredicted EffectPPH Score
thunder APN 17 80053571 missense probably damaging 1.00
IGL01989:Hnrnpll APN 17 80038740 missense probably benign 0.15
IGL02093:Hnrnpll APN 17 80044504 missense probably benign 0.00
IGL02141:Hnrnpll APN 17 80050713 missense probably benign 0.02
IGL02749:Hnrnpll APN 17 80061991 start codon destroyed probably null
IGL03213:Hnrnpll APN 17 80034098 missense probably damaging 1.00
Grell UTSW 17 80034105 missense probably damaging 1.00
Lindsley UTSW 17 80049847 missense probably damaging 1.00
R0477:Hnrnpll UTSW 17 80061832 missense unknown
R1599:Hnrnpll UTSW 17 80053625 missense unknown
R1838:Hnrnpll UTSW 17 80038623 missense probably damaging 1.00
R1907:Hnrnpll UTSW 17 80035329 critical splice donor site probably null
R1978:Hnrnpll UTSW 17 80044518 missense probably benign 0.01
R2079:Hnrnpll UTSW 17 80035377 missense probably benign 0.01
R4061:Hnrnpll UTSW 17 80032772 missense probably benign 0.01
R4062:Hnrnpll UTSW 17 80032772 missense probably benign 0.01
R4064:Hnrnpll UTSW 17 80032772 missense probably benign 0.01
R4226:Hnrnpll UTSW 17 80049805 critical splice donor site probably null
R4625:Hnrnpll UTSW 17 80050862 nonsense probably null
R5175:Hnrnpll UTSW 17 80034070 missense possibly damaging 0.83
R5232:Hnrnpll UTSW 17 80038678 missense probably damaging 1.00
R5620:Hnrnpll UTSW 17 80038622 missense probably damaging 1.00
R5978:Hnrnpll UTSW 17 80034191 missense probably damaging 1.00
R6183:Hnrnpll UTSW 17 80049876 missense possibly damaging 0.46
R6374:Hnrnpll UTSW 17 80049874 missense possibly damaging 0.51
R7120:Hnrnpll UTSW 17 80034057 missense probably benign 0.01
R7429:Hnrnpll UTSW 17 80049847 missense probably damaging 1.00
R7430:Hnrnpll UTSW 17 80049847 missense probably damaging 1.00
R7576:Hnrnpll UTSW 17 80044514 missense possibly damaging 0.91
R8001:Hnrnpll UTSW 17 80038723 nonsense probably null
R8010:Hnrnpll UTSW 17 80061956 missense unknown
R8060:Hnrnpll UTSW 17 80034105 missense probably damaging 1.00
R8068:Hnrnpll UTSW 17 80050852 missense possibly damaging 0.80
R8381:Hnrnpll UTSW 17 80030491 missense probably damaging 1.00
Z1177:Hnrnpll UTSW 17 80048610 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGTAGGCTCTACGTACACAAACCCA -3'
(R):5'- TCCTGGACCAATCCCCTTGGATAAA -3'

Sequencing Primer
(F):5'- ACCAAACTAACAACAAAAAGCAGG -3'
(R):5'- GATAAATGGTTGCCTGCACC -3'
Posted On2014-05-14