Incidental Mutation 'R1700:Trappc8'
Institutional Source Beutler Lab
Gene Symbol Trappc8
Ensembl Gene ENSMUSG00000033382
Gene Nametrafficking protein particle complex 8
SynonymsD030074E01Rik, Trs85, 5033403J15Rik
MMRRC Submission 039733-MU
Accession Numbers

Genbank: NM_029491; MGI: 2443008

Is this an essential gene? Probably essential (E-score: 0.942) question?
Stock #R1700 (G1)
Quality Score225
Status Not validated
Chromosomal Location20817223-20896093 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 20832998 bp
Amino Acid Change Serine to Glycine at position 1128 (S1128G)
Ref Sequence ENSEMBL: ENSMUSP00000153183 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025177] [ENSMUST00000225661]
Predicted Effect probably damaging
Transcript: ENSMUST00000025177
AA Change: S1129G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025177
Gene: ENSMUSG00000033382
AA Change: S1129G

Pfam:TRAPPC-Trs85 157 604 1e-167 PFAM
low complexity region 769 777 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225502
Predicted Effect probably damaging
Transcript: ENSMUST00000225661
AA Change: S1128G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.8%
Validation Efficiency
Allele List at MGI

All alleles(11) : Gene trapped(11)

Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik G A 2: 130,709,938 L1010F probably damaging Het
Abcb1b T C 5: 8,849,537 F936L probably benign Het
Adamts12 T A 15: 11,152,057 I211N probably benign Het
Adamts16 G A 13: 70,779,518 probably benign Het
Alas1 C T 9: 106,239,646 V293I possibly damaging Het
Ap1g1 T C 8: 109,853,612 Y569H probably damaging Het
Apc2 A G 10: 80,312,769 D1190G probably damaging Het
Astn2 G A 4: 65,746,354 Q679* probably null Het
Atp2a1 T A 7: 126,462,909 H5L probably damaging Het
Baiap3 T C 17: 25,249,328 K279E probably damaging Het
C2cd2l G A 9: 44,316,612 P111S probably benign Het
C7 T A 15: 5,002,792 K646* probably null Het
Ccp110 C T 7: 118,735,313 T1003I probably damaging Het
Cdh22 T C 2: 165,170,796 D123G probably damaging Het
Cep295 C T 9: 15,340,883 E397K probably damaging Het
Clip1 A G 5: 123,630,370 V722A probably benign Het
Cpsf4l A G 11: 113,702,075 F174S probably benign Het
Ctnna3 T C 10: 63,852,772 C332R probably damaging Het
Cxcl10 A T 5: 92,347,855 N76K probably damaging Het
Dnaja3 G A 16: 4,684,165 R11K probably null Het
Efcab10 A G 12: 33,395,171 T28A possibly damaging Het
Esrrg A G 1: 188,043,653 R103G probably damaging Het
Exosc2 A G 2: 31,670,806 K23E probably benign Het
Flot2 C T 11: 78,049,547 S40L possibly damaging Het
Fsip2 T C 2: 82,991,737 V5938A probably benign Het
Gclc A G 9: 77,776,289 T143A probably benign Het
Gpr37 A G 6: 25,669,624 V407A probably benign Het
Gucy2e A T 11: 69,232,058 M497K probably benign Het
Herc1 T A 9: 66,450,678 probably null Het
Hnrnpll A C 17: 80,034,105 S502A probably benign Het
Ipo11 G T 13: 106,795,662 T975N probably benign Het
Kif17 C T 4: 138,262,698 Q66* probably null Het
Lrp10 T C 14: 54,469,752 V682A possibly damaging Het
Lsmem1 A T 12: 40,180,678 L75Q probably damaging Het
Med16 A T 10: 79,899,335 Y430N probably benign Het
Med8 C T 4: 118,412,734 S72L possibly damaging Het
Mex3a A G 3: 88,536,375 T253A probably damaging Het
Myf6 T C 10: 107,493,359 K242E probably damaging Het
Ncald T A 15: 37,397,343 Y31F probably benign Het
Ndufa12 T A 10: 94,199,993 Y48N probably damaging Het
Olfr1111 T G 2: 87,149,779 N294T probably damaging Het
Olfr1145 T C 2: 87,810,768 V316A probably benign Het
Olfr638 T A 7: 104,004,122 Y282* probably null Het
Pde4dip T C 3: 97,703,323 T1858A probably benign Het
Pgbd1 A G 13: 21,434,481 L2P probably damaging Het
Piezo1 C T 8: 122,487,502 R1642H probably damaging Het
Plxna1 A T 6: 89,357,008 M213K probably damaging Het
Polr1b A G 2: 129,123,121 N709S probably damaging Het
Pramel1 T A 4: 143,398,429 W308R probably damaging Het
Prkag2 A T 5: 24,871,541 I208N probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rngtt T A 4: 33,330,864 F156I probably damaging Het
Rpusd3 A G 6: 113,415,533 *345Q probably null Het
Rrp1b A G 17: 32,057,204 K575R probably benign Het
Shd G A 17: 55,974,307 V250I probably damaging Het
Slc12a5 C A 2: 164,992,376 N749K possibly damaging Het
Sorbs2 T A 8: 45,800,984 V488D probably damaging Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Srsf4 C A 4: 131,900,560 probably benign Het
Strn T C 17: 78,692,402 Y135C probably damaging Het
Synm T C 7: 67,759,628 M1V probably null Het
Tas1r3 T G 4: 155,861,570 Q489P probably benign Het
Tas2r103 A T 6: 133,036,811 N97K probably damaging Het
Tas2r113 A G 6: 132,893,792 Y261C possibly damaging Het
Tex21 T C 12: 76,221,672 E112G probably damaging Het
Ubap1l A G 9: 65,371,743 probably benign Het
Ubash3a A G 17: 31,215,044 D121G probably damaging Het
Ubxn4 A G 1: 128,252,286 I56V possibly damaging Het
Uri1 T C 7: 37,963,524 I348M probably damaging Het
Usp21 C A 1: 171,283,722 L379F probably damaging Het
Vmn1r159 T A 7: 22,842,965 H214L probably damaging Het
Zdbf2 A G 1: 63,302,741 E93G unknown Het
Other mutations in Trappc8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01077:Trappc8 APN 18 20836978 missense probably benign 0.20
IGL01367:Trappc8 APN 18 20866119 missense probably benign 0.01
IGL01537:Trappc8 APN 18 20835004 missense probably benign
IGL01563:Trappc8 APN 18 20837046 missense probably benign 0.00
IGL01982:Trappc8 APN 18 20874712 splice site probably benign
IGL02709:Trappc8 APN 18 20837178 missense possibly damaging 0.94
IGL03126:Trappc8 APN 18 20863595 missense probably damaging 1.00
IGL03290:Trappc8 APN 18 20820935 missense probably damaging 1.00
IGL03348:Trappc8 APN 18 20852781 missense probably damaging 1.00
hoppa UTSW 18 20836900 missense probably benign 0.05
Lagomorpha UTSW 18 20818190 missense probably benign 0.11
rabbit UTSW 18 20874680 missense probably damaging 1.00
E7848:Trappc8 UTSW 18 20850918 missense probably damaging 0.99
R0483:Trappc8 UTSW 18 20845601 missense possibly damaging 0.60
R0492:Trappc8 UTSW 18 20866186 missense probably benign 0.07
R0506:Trappc8 UTSW 18 20844188 missense possibly damaging 0.49
R0610:Trappc8 UTSW 18 20837188 missense probably damaging 1.00
R0892:Trappc8 UTSW 18 20831608 critical splice donor site probably null
R1561:Trappc8 UTSW 18 20841623 nonsense probably null
R1589:Trappc8 UTSW 18 20863551 missense probably damaging 1.00
R1785:Trappc8 UTSW 18 20834940 splice site probably null
R1786:Trappc8 UTSW 18 20834940 splice site probably null
R1989:Trappc8 UTSW 18 20845651 missense probably benign 0.04
R2181:Trappc8 UTSW 18 20819222 critical splice donor site probably null
R2294:Trappc8 UTSW 18 20866154 nonsense probably null
R4551:Trappc8 UTSW 18 20874672 missense probably benign 0.10
R4594:Trappc8 UTSW 18 20836948 missense probably benign
R4631:Trappc8 UTSW 18 20867808 missense probably benign 0.22
R4734:Trappc8 UTSW 18 20841572 nonsense probably null
R4834:Trappc8 UTSW 18 20825065 missense probably damaging 0.99
R5114:Trappc8 UTSW 18 20844180 missense probably benign 0.04
R5262:Trappc8 UTSW 18 20818190 missense probably benign 0.11
R5384:Trappc8 UTSW 18 20833062 splice site probably null
R5476:Trappc8 UTSW 18 20865108 missense probably damaging 1.00
R5503:Trappc8 UTSW 18 20836900 missense probably benign 0.05
R5577:Trappc8 UTSW 18 20836779 nonsense probably null
R5809:Trappc8 UTSW 18 20818082 missense probably benign 0.08
R5825:Trappc8 UTSW 18 20873920 missense probably damaging 1.00
R5886:Trappc8 UTSW 18 20874680 missense probably damaging 1.00
R5936:Trappc8 UTSW 18 20874688 missense probably damaging 1.00
R6024:Trappc8 UTSW 18 20833009 missense probably damaging 0.98
R6105:Trappc8 UTSW 18 20846447 critical splice donor site probably null
R6229:Trappc8 UTSW 18 20870745 missense probably benign 0.00
R6376:Trappc8 UTSW 18 20837075 missense probably benign 0.07
R6403:Trappc8 UTSW 18 20866071 missense probably benign
R6459:Trappc8 UTSW 18 20836868 missense probably benign 0.40
R6673:Trappc8 UTSW 18 20885257 missense probably benign 0.01
R7041:Trappc8 UTSW 18 20874672 missense probably benign 0.10
R7276:Trappc8 UTSW 18 20818091 missense probably damaging 0.99
R7341:Trappc8 UTSW 18 20852647 missense probably damaging 1.00
R7684:Trappc8 UTSW 18 20863502 missense probably benign 0.01
R7702:Trappc8 UTSW 18 20825062 missense probably damaging 0.99
R8210:Trappc8 UTSW 18 20873881 critical splice donor site probably null
X0065:Trappc8 UTSW 18 20860522 missense probably benign 0.03
Z1177:Trappc8 UTSW 18 20831663 frame shift probably null
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- ccccatttcctatctgttctctc -3'
Posted On2014-05-14