Mutagenetix > Incidental Mutation

Incidental Mutation 'R1701:Intu'

189704

Institutional Source

Beutler Lab

Gene Symbol

Intu

Ensembl Gene

ENSMUSG00000060798

Gene Name

inturned planar cell polarity protein

Synonyms

Pdzd6, Pdzk6, 9430087H23Rik, 9230116I04Rik

MMRRC Submission

039734-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1701 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

40531286-40704774 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 40664264 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 233 (D233E)

Ref Sequence

ENSEMBL: ENSMUSP00000088725 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091186]

AlphaFold

Q059U7

Predicted Effect

probably damaging
Transcript: ENSMUST00000091186
AA Change: D233E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000088725
Gene: ENSMUSG00000060798
AA Change: D233E

Domain	Start	End	E-Value	Type
low complexity region	21	48	N/A	INTRINSIC
low complexity region	64	81	N/A	INTRINSIC
PDZ	187	269	2.09e-3	SMART
low complexity region	459	468	N/A	INTRINSIC
low complexity region	774	784	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 93.8%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygous null mice show defective ciliogenesis and neural tube closure, abnormal patterning of the CNS and limbs, polydactyly, edema and death by E16.5. Homozygotes for a hypomorphic allele show defective ciliation and endochondral ossification, stunted growth, polydactyly and postnatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aadacl3	A	G	4: 144,463,572	L53P	probably damaging	Het
Acadsb	T	A	7: 131,424,484	F19I	probably benign	Het
Aldh3a2	C	T	11: 61,256,772	G303S	probably damaging	Het
Anks1b	T	C	10: 90,049,954	Y171H	probably damaging	Het
Anxa7	A	T	14: 20,460,161	I385N	probably damaging	Het
Astn1	A	T	1: 158,504,307	T324S	possibly damaging	Het
Ccdc88a	T	C	11: 29,477,427	V235A	possibly damaging	Het
Crhr2	T	C	6: 55,099,270	K258R	probably damaging	Het
Ctnnd1	T	C	2: 84,608,991	E786G	probably damaging	Het
Ctnnd2	G	A	15: 30,921,981	D918N	probably damaging	Het
Dnah9	A	G	11: 65,911,924	S200P	probably damaging	Het
Dot1l	T	C	10: 80,790,742	S1266P	possibly damaging	Het
Efemp1	A	G	11: 28,921,750	T422A	possibly damaging	Het
Fam135b	T	C	15: 71,459,729	H1137R	probably damaging	Het
Flot2	C	T	11: 78,049,547	S40L	possibly damaging	Het
Fras1	G	A	5: 96,600,784	S706N	probably benign	Het
Gbf1	T	C	19: 46,261,675	L357P	probably damaging	Het
Gm17689	A	G	9: 36,581,818		probably benign	Het
Gpatch2l	A	G	12: 86,288,952	S476G	probably benign	Het
Hbb-bh2	T	C	7: 103,840,243	T34A	probably benign	Het
Ints8	A	G	4: 11,231,656	L443P	probably damaging	Het
Kctd1	T	A	18: 14,969,560	I259L	possibly damaging	Het
Lama5	A	G	2: 180,221,369	C108R	probably damaging	Het
Lgals3bp	T	C	11: 118,393,955	Y266C	probably damaging	Het
Lrig2	T	C	3: 104,494,677	I111V	probably benign	Het
Myh8	G	T	11: 67,280,138	C125F	probably damaging	Het
Olfr1140	T	A	2: 87,746,550	M118K	probably damaging	Het
Olfr203	T	C	16: 59,303,288	I46T	probably benign	Het
Olfr502	T	G	7: 108,523,524	Q142P	probably benign	Het
Olfr642	T	C	7: 104,050,195	E53G	possibly damaging	Het
Olfr709-ps1	C	A	7: 106,926,922	C179F	probably damaging	Het
Olfr771	T	C	10: 129,160,105	Q293R	probably damaging	Het
Olfr90	C	T	17: 37,085,731	V145M	probably benign	Het
Olfr967	A	T	9: 39,751,069	I228F	probably damaging	Het
Phc2	C	T	4: 128,751,607	P836S	probably damaging	Het
Pla2g7	T	C	17: 43,600,524	F189S	probably damaging	Het
Ptprk	A	G	10: 28,466,058	D487G	probably damaging	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Rad54l2	A	G	9: 106,700,493		probably null	Het
Robo4	G	T	9: 37,403,443	V198L	probably benign	Het
Selenbp1	C	A	3: 94,937,390	H119Q	probably damaging	Het
Slc25a13	T	C	6: 6,152,525		probably null	Het
Slc35f5	A	G	1: 125,570,593	E176G	possibly damaging	Het
Soga1	T	C	2: 157,030,619	N936S	probably damaging	Het
Sphkap	G	A	1: 83,277,515	R838*	probably null	Het
Ssfa2	A	G	2: 79,636,050	K75E	probably damaging	Het
Tenm4	G	A	7: 96,902,889	V2512M	probably damaging	Het
Tmc8	A	G	11: 117,791,362		probably null	Het
Trim30d	C	T	7: 104,484,182	W21*	probably null	Het
Ube3c	G	A	5: 29,601,202	V281I	probably benign	Het
Usp17ld	T	C	7: 103,250,576	K383R	probably benign	Het
Vmn1r172	A	T	7: 23,660,104	Y138F	probably damaging	Het
Vmn1r180	T	C	7: 23,952,970	V186A	possibly damaging	Het
Vmn2r25	T	A	6: 123,851,795		probably null	Het
Vmn2r61	T	C	7: 42,300,511	F785S	probably damaging	Het
Zfp141	T	A	7: 42,476,046	Y334F	probably benign	Het
Zfp609	T	C	9: 65,731,000	I317V	probably benign	Het
Zfp879	A	G	11: 50,833,233	I259T	possibly damaging	Het

Other mutations in Intu

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01292:Intu	APN	3	40664266	missense	probably benign	0.12
IGL01386:Intu	APN	3	40692587	missense	probably damaging	1.00
IGL02645:Intu	APN	3	40701272	missense	probably benign	0.01
IGL02869:Intu	APN	3	40687786	missense	probably damaging	1.00
IGL03263:Intu	APN	3	40672597	nonsense	probably null
H8562:Intu	UTSW	3	40692673	missense	probably damaging	1.00
PIT4495001:Intu	UTSW	3	40697603	missense	probably benign	0.07
R0010:Intu	UTSW	3	40654272	intron	probably benign
R0173:Intu	UTSW	3	40675346	critical splice donor site	probably null
R0426:Intu	UTSW	3	40675305	missense	probably damaging	0.97
R1566:Intu	UTSW	3	40692578	missense	probably damaging	0.99
R1619:Intu	UTSW	3	40697631	nonsense	probably null
R1658:Intu	UTSW	3	40692781	missense	probably benign	0.20
R1707:Intu	UTSW	3	40540924	missense	probably benign	0.03
R1707:Intu	UTSW	3	40683501	missense	possibly damaging	0.69
R1867:Intu	UTSW	3	40664335	missense	probably damaging	1.00
R1868:Intu	UTSW	3	40664335	missense	probably damaging	1.00
R2090:Intu	UTSW	3	40683536	missense	probably benign	0.00
R2310:Intu	UTSW	3	40653813	missense	probably benign
R2989:Intu	UTSW	3	40692710	missense	probably benign	0.11
R4168:Intu	UTSW	3	40672623	missense	probably benign	0.00
R4530:Intu	UTSW	3	40683364	missense	possibly damaging	0.95
R5093:Intu	UTSW	3	40692917	missense	probably benign	0.00
R5541:Intu	UTSW	3	40692587	splice site	probably null
R5587:Intu	UTSW	3	40675308	missense	probably damaging	0.99
R5745:Intu	UTSW	3	40692972	splice site	probably null
R5809:Intu	UTSW	3	40679590	missense	probably damaging	0.99
R5939:Intu	UTSW	3	40692584	missense	probably damaging	1.00
R5953:Intu	UTSW	3	40679550	missense	probably damaging	1.00
R6000:Intu	UTSW	3	40654148	nonsense	probably null
R6063:Intu	UTSW	3	40654094	missense	probably damaging	0.97
R6245:Intu	UTSW	3	40675326	missense	probably damaging	0.98
R6310:Intu	UTSW	3	40701291	nonsense	probably null
R6353:Intu	UTSW	3	40653708	missense	probably damaging	1.00
R6451:Intu	UTSW	3	40701293	missense	possibly damaging	0.94
R6660:Intu	UTSW	3	40531951	missense	probably benign	0.00
R6848:Intu	UTSW	3	40694255	missense	probably benign	0.00
R7440:Intu	UTSW	3	40697551	missense	probably benign	0.04
R7625:Intu	UTSW	3	40697599	missense	probably benign
R7633:Intu	UTSW	3	40654253	missense	probably damaging	1.00
R7798:Intu	UTSW	3	40691929	missense	probably damaging	1.00
R7877:Intu	UTSW	3	40699792	missense	probably benign	0.07
R7978:Intu	UTSW	3	40697639	missense	probably damaging	1.00
R8319:Intu	UTSW	3	40653772	missense	probably damaging	1.00
R8332:Intu	UTSW	3	40675289	missense	probably benign	0.35
R8860:Intu	UTSW	3	40672732	missense	probably benign	0.07
R8926:Intu	UTSW	3	40653709	missense	possibly damaging	0.69
R8946:Intu	UTSW	3	40683359	missense	possibly damaging	0.93
R9164:Intu	UTSW	3	40690703	missense	probably damaging	1.00
R9191:Intu	UTSW	3	40692511	missense	probably damaging	0.99
R9547:Intu	UTSW	3	40654106	missense	probably benign
Z1177:Intu	UTSW	3	40697516	missense	possibly damaging	0.80

Predicted Primers

PCR Primer
(F):5'- TCGCCCAGTTATCCCAAGACTAGAC -3'
(R):5'- TTAGCAAAAGGCGAAGCTGCCC -3'

Sequencing Primer
(F):5'- CAGTTATCCCAAGACTAGACGTATTC -3'
(R):5'- TGAGTGGGACTCACCCATTAC -3'

Posted On

2014-05-14