Incidental Mutation 'R1701:Vmn2r61'
ID189718
Institutional Source Beutler Lab
Gene Symbol Vmn2r61
Ensembl Gene ENSMUSG00000090967
Gene Namevomeronasal 2, receptor 61
SynonymsEG637873, Casr-rs2, Gprc2a-rs2
MMRRC Submission 039734-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R1701 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location42260053-42300755 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 42300511 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 785 (F785S)
Ref Sequence ENSEMBL: ENSMUSP00000129576 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166131]
Predicted Effect probably damaging
Transcript: ENSMUST00000166131
AA Change: F785S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129576
Gene: ENSMUSG00000090967
AA Change: F785S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 471 4e-42 PFAM
Pfam:NCD3G 514 567 1.9e-21 PFAM
Pfam:7tm_3 600 835 6.2e-52 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173044
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl3 A G 4: 144,463,572 L53P probably damaging Het
Acadsb T A 7: 131,424,484 F19I probably benign Het
Aldh3a2 C T 11: 61,256,772 G303S probably damaging Het
Anks1b T C 10: 90,049,954 Y171H probably damaging Het
Anxa7 A T 14: 20,460,161 I385N probably damaging Het
Astn1 A T 1: 158,504,307 T324S possibly damaging Het
Ccdc88a T C 11: 29,477,427 V235A possibly damaging Het
Crhr2 T C 6: 55,099,270 K258R probably damaging Het
Ctnnd1 T C 2: 84,608,991 E786G probably damaging Het
Ctnnd2 G A 15: 30,921,981 D918N probably damaging Het
Dnah9 A G 11: 65,911,924 S200P probably damaging Het
Dot1l T C 10: 80,790,742 S1266P possibly damaging Het
Efemp1 A G 11: 28,921,750 T422A possibly damaging Het
Fam135b T C 15: 71,459,729 H1137R probably damaging Het
Flot2 C T 11: 78,049,547 S40L possibly damaging Het
Fras1 G A 5: 96,600,784 S706N probably benign Het
Gbf1 T C 19: 46,261,675 L357P probably damaging Het
Gm17689 A G 9: 36,581,818 probably benign Het
Gpatch2l A G 12: 86,288,952 S476G probably benign Het
Hbb-bh2 T C 7: 103,840,243 T34A probably benign Het
Ints8 A G 4: 11,231,656 L443P probably damaging Het
Intu T A 3: 40,664,264 D233E probably damaging Het
Kctd1 T A 18: 14,969,560 I259L possibly damaging Het
Lama5 A G 2: 180,221,369 C108R probably damaging Het
Lgals3bp T C 11: 118,393,955 Y266C probably damaging Het
Lrig2 T C 3: 104,494,677 I111V probably benign Het
Myh8 G T 11: 67,280,138 C125F probably damaging Het
Olfr1140 T A 2: 87,746,550 M118K probably damaging Het
Olfr203 T C 16: 59,303,288 I46T probably benign Het
Olfr502 T G 7: 108,523,524 Q142P probably benign Het
Olfr642 T C 7: 104,050,195 E53G possibly damaging Het
Olfr709-ps1 C A 7: 106,926,922 C179F probably damaging Het
Olfr771 T C 10: 129,160,105 Q293R probably damaging Het
Olfr90 C T 17: 37,085,731 V145M probably benign Het
Olfr967 A T 9: 39,751,069 I228F probably damaging Het
Phc2 C T 4: 128,751,607 P836S probably damaging Het
Pla2g7 T C 17: 43,600,524 F189S probably damaging Het
Ptprk A G 10: 28,466,058 D487G probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rad54l2 A G 9: 106,700,493 probably null Het
Robo4 G T 9: 37,403,443 V198L probably benign Het
Selenbp1 C A 3: 94,937,390 H119Q probably damaging Het
Slc25a13 T C 6: 6,152,525 probably null Het
Slc35f5 A G 1: 125,570,593 E176G possibly damaging Het
Soga1 T C 2: 157,030,619 N936S probably damaging Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Ssfa2 A G 2: 79,636,050 K75E probably damaging Het
Tenm4 G A 7: 96,902,889 V2512M probably damaging Het
Tmc8 A G 11: 117,791,362 probably null Het
Trim30d C T 7: 104,484,182 W21* probably null Het
Ube3c G A 5: 29,601,202 V281I probably benign Het
Usp17ld T C 7: 103,250,576 K383R probably benign Het
Vmn1r172 A T 7: 23,660,104 Y138F probably damaging Het
Vmn1r180 T C 7: 23,952,970 V186A possibly damaging Het
Vmn2r25 T A 6: 123,851,795 probably null Het
Zfp141 T A 7: 42,476,046 Y334F probably benign Het
Zfp609 T C 9: 65,731,000 I317V probably benign Het
Zfp879 A G 11: 50,833,233 I259T possibly damaging Het
Other mutations in Vmn2r61
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Vmn2r61 APN 7 42300751 missense possibly damaging 0.96
IGL00824:Vmn2r61 APN 7 42267014 missense probably benign 0.03
IGL00903:Vmn2r61 APN 7 42300511 missense probably damaging 1.00
IGL01125:Vmn2r61 APN 7 42260126 missense probably damaging 1.00
IGL01393:Vmn2r61 APN 7 42266834 missense probably benign 0.08
IGL01712:Vmn2r61 APN 7 42260237 missense probably damaging 0.98
IGL01822:Vmn2r61 APN 7 42300706 missense probably benign 0.18
IGL01835:Vmn2r61 APN 7 42300591 missense probably benign 0.12
IGL01844:Vmn2r61 APN 7 42260215 missense probably benign 0.00
IGL01953:Vmn2r61 APN 7 42300189 missense probably damaging 1.00
IGL02032:Vmn2r61 APN 7 42300042 missense probably damaging 0.99
IGL02054:Vmn2r61 APN 7 42276734 critical splice donor site probably null
IGL02569:Vmn2r61 APN 7 42276646 missense probably damaging 1.00
IGL02697:Vmn2r61 APN 7 42275468 missense possibly damaging 0.55
IGL02958:Vmn2r61 APN 7 42299937 missense probably benign
IGL03290:Vmn2r61 APN 7 42265984 missense probably benign 0.00
IGL03337:Vmn2r61 APN 7 42267085 missense possibly damaging 0.58
IGL03369:Vmn2r61 APN 7 42260093 missense probably benign
IGL03402:Vmn2r61 APN 7 42260255 missense probably benign
R0026:Vmn2r61 UTSW 7 42275474 missense possibly damaging 0.64
R0319:Vmn2r61 UTSW 7 42300517 missense probably damaging 0.99
R0433:Vmn2r61 UTSW 7 42265911 missense probably benign 0.02
R0555:Vmn2r61 UTSW 7 42266018 missense probably benign 0.02
R0691:Vmn2r61 UTSW 7 42300420 missense probably damaging 1.00
R1718:Vmn2r61 UTSW 7 42300697 missense probably benign
R1835:Vmn2r61 UTSW 7 42266652 nonsense probably null
R1920:Vmn2r61 UTSW 7 42300286 missense possibly damaging 0.73
R2069:Vmn2r61 UTSW 7 42300001 missense probably benign 0.06
R2326:Vmn2r61 UTSW 7 42266863 missense probably damaging 1.00
R2402:Vmn2r61 UTSW 7 42300105 missense possibly damaging 0.90
R3103:Vmn2r61 UTSW 7 42266643 missense possibly damaging 0.73
R3107:Vmn2r61 UTSW 7 42267067 missense possibly damaging 0.82
R4426:Vmn2r61 UTSW 7 42300733 missense probably benign
R4426:Vmn2r61 UTSW 7 42300735 missense probably benign
R4484:Vmn2r61 UTSW 7 42300696 missense probably benign
R4748:Vmn2r61 UTSW 7 42267141 missense probably damaging 0.96
R4835:Vmn2r61 UTSW 7 42267035 missense possibly damaging 0.52
R4863:Vmn2r61 UTSW 7 42300708 missense probably benign 0.03
R4923:Vmn2r61 UTSW 7 42267096 missense probably damaging 1.00
R4968:Vmn2r61 UTSW 7 42300054 missense probably benign 0.14
R5114:Vmn2r61 UTSW 7 42300529 missense possibly damaging 0.92
R5297:Vmn2r61 UTSW 7 42260222 missense probably benign
R5497:Vmn2r61 UTSW 7 42275482 missense possibly damaging 0.95
R5508:Vmn2r61 UTSW 7 42266818 missense possibly damaging 0.52
R5587:Vmn2r61 UTSW 7 42300487 missense probably damaging 1.00
R5615:Vmn2r61 UTSW 7 42300493 missense probably damaging 1.00
R5615:Vmn2r61 UTSW 7 42267253 missense probably benign 0.00
R5782:Vmn2r61 UTSW 7 42299829 missense probably damaging 1.00
R6136:Vmn2r61 UTSW 7 42267031 missense probably damaging 1.00
R6207:Vmn2r61 UTSW 7 42260192 missense probably benign 0.01
R6265:Vmn2r61 UTSW 7 42266491 missense probably benign 0.01
R6272:Vmn2r61 UTSW 7 42299818 missense probably damaging 1.00
R6355:Vmn2r61 UTSW 7 42267235 missense probably benign 0.00
R6469:Vmn2r61 UTSW 7 42265859 nonsense probably null
R6554:Vmn2r61 UTSW 7 42276715 missense probably damaging 1.00
R6699:Vmn2r61 UTSW 7 42300156 missense probably benign
R6768:Vmn2r61 UTSW 7 42300324 missense probably damaging 1.00
R6824:Vmn2r61 UTSW 7 42299979 missense probably benign 0.10
R6930:Vmn2r61 UTSW 7 42299940 missense probably benign 0.02
R7053:Vmn2r61 UTSW 7 42267133 missense probably damaging 0.96
R7238:Vmn2r61 UTSW 7 42267205 missense possibly damaging 0.73
R7332:Vmn2r61 UTSW 7 42260110 missense probably benign 0.00
R7359:Vmn2r61 UTSW 7 42265983 missense probably benign 0.11
R7553:Vmn2r61 UTSW 7 42266781 missense not run
R7710:Vmn2r61 UTSW 7 42267048 missense probably damaging 1.00
R7732:Vmn2r61 UTSW 7 42266673 missense probably benign
R7839:Vmn2r61 UTSW 7 42266608 missense probably damaging 0.97
R7916:Vmn2r61 UTSW 7 42300511 missense probably damaging 1.00
R8026:Vmn2r61 UTSW 7 42266717 missense probably benign 0.02
Z1088:Vmn2r61 UTSW 7 42299964 missense possibly damaging 0.93
Z1176:Vmn2r61 UTSW 7 42260161 missense possibly damaging 0.46
Z1176:Vmn2r61 UTSW 7 42266742 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCAGGCTGAACATGGTCACATCATC -3'
(R):5'- TGCTGACACATCTTCCACAGGAAC -3'

Sequencing Primer
(F):5'- CTACACCATGGCCTTCTTGT -3'
(R):5'- TTATGGGACACTAGGCCAAC -3'
Posted On2014-05-14