Incidental Mutation 'R1701:Usp17ld'
ID 189721
Institutional Source Beutler Lab
Gene Symbol Usp17ld
Ensembl Gene ENSMUSG00000057321
Gene Name ubiquitin specific peptidase 17-like D
Synonyms Dub2a
MMRRC Submission 039734-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock # R1701 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 103249737-103252505 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 103250576 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 383 (K383R)
Ref Sequence ENSEMBL: ENSMUSP00000073107 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073394]
AlphaFold G5E8G2
Predicted Effect probably benign
Transcript: ENSMUST00000073394
AA Change: K383R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000073107
Gene: ENSMUSG00000057321
AA Change: K383R

DomainStartEndE-ValueType
Pfam:UCH 50 345 2.4e-54 PFAM
Pfam:UCH_1 51 327 2e-25 PFAM
low complexity region 374 385 N/A INTRINSIC
low complexity region 529 542 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl3 A G 4: 144,463,572 L53P probably damaging Het
Acadsb T A 7: 131,424,484 F19I probably benign Het
Aldh3a2 C T 11: 61,256,772 G303S probably damaging Het
Anks1b T C 10: 90,049,954 Y171H probably damaging Het
Anxa7 A T 14: 20,460,161 I385N probably damaging Het
Astn1 A T 1: 158,504,307 T324S possibly damaging Het
Ccdc88a T C 11: 29,477,427 V235A possibly damaging Het
Crhr2 T C 6: 55,099,270 K258R probably damaging Het
Ctnnd1 T C 2: 84,608,991 E786G probably damaging Het
Ctnnd2 G A 15: 30,921,981 D918N probably damaging Het
Dnah9 A G 11: 65,911,924 S200P probably damaging Het
Dot1l T C 10: 80,790,742 S1266P possibly damaging Het
Efemp1 A G 11: 28,921,750 T422A possibly damaging Het
Fam135b T C 15: 71,459,729 H1137R probably damaging Het
Flot2 C T 11: 78,049,547 S40L possibly damaging Het
Fras1 G A 5: 96,600,784 S706N probably benign Het
Gbf1 T C 19: 46,261,675 L357P probably damaging Het
Gm17689 A G 9: 36,581,818 probably benign Het
Gpatch2l A G 12: 86,288,952 S476G probably benign Het
Hbb-bh2 T C 7: 103,840,243 T34A probably benign Het
Ints8 A G 4: 11,231,656 L443P probably damaging Het
Intu T A 3: 40,664,264 D233E probably damaging Het
Kctd1 T A 18: 14,969,560 I259L possibly damaging Het
Lama5 A G 2: 180,221,369 C108R probably damaging Het
Lgals3bp T C 11: 118,393,955 Y266C probably damaging Het
Lrig2 T C 3: 104,494,677 I111V probably benign Het
Myh8 G T 11: 67,280,138 C125F probably damaging Het
Olfr1140 T A 2: 87,746,550 M118K probably damaging Het
Olfr203 T C 16: 59,303,288 I46T probably benign Het
Olfr502 T G 7: 108,523,524 Q142P probably benign Het
Olfr642 T C 7: 104,050,195 E53G possibly damaging Het
Olfr709-ps1 C A 7: 106,926,922 C179F probably damaging Het
Olfr771 T C 10: 129,160,105 Q293R probably damaging Het
Olfr90 C T 17: 37,085,731 V145M probably benign Het
Olfr967 A T 9: 39,751,069 I228F probably damaging Het
Phc2 C T 4: 128,751,607 P836S probably damaging Het
Pla2g7 T C 17: 43,600,524 F189S probably damaging Het
Ptprk A G 10: 28,466,058 D487G probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rad54l2 A G 9: 106,700,493 probably null Het
Robo4 G T 9: 37,403,443 V198L probably benign Het
Selenbp1 C A 3: 94,937,390 H119Q probably damaging Het
Slc25a13 T C 6: 6,152,525 probably null Het
Slc35f5 A G 1: 125,570,593 E176G possibly damaging Het
Soga1 T C 2: 157,030,619 N936S probably damaging Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Ssfa2 A G 2: 79,636,050 K75E probably damaging Het
Tenm4 G A 7: 96,902,889 V2512M probably damaging Het
Tmc8 A G 11: 117,791,362 probably null Het
Trim30d C T 7: 104,484,182 W21* probably null Het
Ube3c G A 5: 29,601,202 V281I probably benign Het
Vmn1r172 A T 7: 23,660,104 Y138F probably damaging Het
Vmn1r180 T C 7: 23,952,970 V186A possibly damaging Het
Vmn2r25 T A 6: 123,851,795 probably null Het
Vmn2r61 T C 7: 42,300,511 F785S probably damaging Het
Zfp141 T A 7: 42,476,046 Y334F probably benign Het
Zfp609 T C 9: 65,731,000 I317V probably benign Het
Zfp879 A G 11: 50,833,233 I259T possibly damaging Het
Other mutations in Usp17ld
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00705:Usp17ld APN 7 103250438 missense probably benign 0.00
IGL01754:Usp17ld APN 7 103250663 missense probably benign
IGL02422:Usp17ld APN 7 103250760 missense probably damaging 1.00
R3113:Usp17ld UTSW 7 103250663 missense probably benign 0.01
R5057:Usp17ld UTSW 7 103250448 missense probably benign 0.07
R5161:Usp17ld UTSW 7 103250372 nonsense probably null
R5259:Usp17ld UTSW 7 103250574 nonsense probably null
R5656:Usp17ld UTSW 7 103250840 missense probably damaging 1.00
R6528:Usp17ld UTSW 7 103250755 missense probably damaging 1.00
R7573:Usp17ld UTSW 7 103250887 nonsense probably null
R7688:Usp17ld UTSW 7 103250775 missense probably damaging 1.00
R7711:Usp17ld UTSW 7 103250282 missense probably damaging 0.99
R7800:Usp17ld UTSW 7 103250834 missense probably damaging 1.00
R8099:Usp17ld UTSW 7 103250288 missense probably damaging 1.00
R8303:Usp17ld UTSW 7 103250816 missense probably damaging 1.00
R9388:Usp17ld UTSW 7 103250938 missense probably benign 0.01
R9486:Usp17ld UTSW 7 103250174 missense probably benign 0.29
R9620:Usp17ld UTSW 7 103250972 missense possibly damaging 0.78
RF009:Usp17ld UTSW 7 103250288 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATCAAGTTCACCTTCCGTGTTCC -3'
(R):5'- AGCTGCGATGTGACTTCTGTCC -3'

Sequencing Primer
(F):5'- CCTGAGGCAAGATTTCATTGTTC -3'
(R):5'- CCTGAATGAGAATGCCTATGTGC -3'
Posted On 2014-05-14