Incidental Mutation 'R1701:Olfr502'
ID189726
Institutional Source Beutler Lab
Gene Symbol Olfr502
Ensembl Gene ENSMUSG00000058014
Gene Nameolfactory receptor 502
SynonymsGA_x6K02T2PBJ9-10853935-10852991, MOR204-8
MMRRC Submission 039734-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R1701 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location108520825-108525065 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 108523524 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Proline at position 142 (Q142P)
Ref Sequence ENSEMBL: ENSMUSP00000151167 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078933] [ENSMUST00000216919]
Predicted Effect probably benign
Transcript: ENSMUST00000078933
AA Change: Q142P

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000077963
Gene: ENSMUSG00000058014
AA Change: Q142P

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 4.8e-55 PFAM
Pfam:7tm_1 44 293 7.7e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208361
Predicted Effect probably benign
Transcript: ENSMUST00000216919
AA Change: Q142P

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl3 A G 4: 144,463,572 L53P probably damaging Het
Acadsb T A 7: 131,424,484 F19I probably benign Het
Aldh3a2 C T 11: 61,256,772 G303S probably damaging Het
Anks1b T C 10: 90,049,954 Y171H probably damaging Het
Anxa7 A T 14: 20,460,161 I385N probably damaging Het
Astn1 A T 1: 158,504,307 T324S possibly damaging Het
Ccdc88a T C 11: 29,477,427 V235A possibly damaging Het
Crhr2 T C 6: 55,099,270 K258R probably damaging Het
Ctnnd1 T C 2: 84,608,991 E786G probably damaging Het
Ctnnd2 G A 15: 30,921,981 D918N probably damaging Het
Dnah9 A G 11: 65,911,924 S200P probably damaging Het
Dot1l T C 10: 80,790,742 S1266P possibly damaging Het
Efemp1 A G 11: 28,921,750 T422A possibly damaging Het
Fam135b T C 15: 71,459,729 H1137R probably damaging Het
Flot2 C T 11: 78,049,547 S40L possibly damaging Het
Fras1 G A 5: 96,600,784 S706N probably benign Het
Gbf1 T C 19: 46,261,675 L357P probably damaging Het
Gm17689 A G 9: 36,581,818 probably benign Het
Gpatch2l A G 12: 86,288,952 S476G probably benign Het
Hbb-bh2 T C 7: 103,840,243 T34A probably benign Het
Ints8 A G 4: 11,231,656 L443P probably damaging Het
Intu T A 3: 40,664,264 D233E probably damaging Het
Kctd1 T A 18: 14,969,560 I259L possibly damaging Het
Lama5 A G 2: 180,221,369 C108R probably damaging Het
Lgals3bp T C 11: 118,393,955 Y266C probably damaging Het
Lrig2 T C 3: 104,494,677 I111V probably benign Het
Myh8 G T 11: 67,280,138 C125F probably damaging Het
Olfr1140 T A 2: 87,746,550 M118K probably damaging Het
Olfr203 T C 16: 59,303,288 I46T probably benign Het
Olfr642 T C 7: 104,050,195 E53G possibly damaging Het
Olfr709-ps1 C A 7: 106,926,922 C179F probably damaging Het
Olfr771 T C 10: 129,160,105 Q293R probably damaging Het
Olfr90 C T 17: 37,085,731 V145M probably benign Het
Olfr967 A T 9: 39,751,069 I228F probably damaging Het
Phc2 C T 4: 128,751,607 P836S probably damaging Het
Pla2g7 T C 17: 43,600,524 F189S probably damaging Het
Ptprk A G 10: 28,466,058 D487G probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rad54l2 A G 9: 106,700,493 probably null Het
Robo4 G T 9: 37,403,443 V198L probably benign Het
Selenbp1 C A 3: 94,937,390 H119Q probably damaging Het
Slc25a13 T C 6: 6,152,525 probably null Het
Slc35f5 A G 1: 125,570,593 E176G possibly damaging Het
Soga1 T C 2: 157,030,619 N936S probably damaging Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Ssfa2 A G 2: 79,636,050 K75E probably damaging Het
Tenm4 G A 7: 96,902,889 V2512M probably damaging Het
Tmc8 A G 11: 117,791,362 probably null Het
Trim30d C T 7: 104,484,182 W21* probably null Het
Ube3c G A 5: 29,601,202 V281I probably benign Het
Usp17ld T C 7: 103,250,576 K383R probably benign Het
Vmn1r172 A T 7: 23,660,104 Y138F probably damaging Het
Vmn1r180 T C 7: 23,952,970 V186A possibly damaging Het
Vmn2r25 T A 6: 123,851,795 probably null Het
Vmn2r61 T C 7: 42,300,511 F785S probably damaging Het
Zfp141 T A 7: 42,476,046 Y334F probably benign Het
Zfp609 T C 9: 65,731,000 I317V probably benign Het
Zfp879 A G 11: 50,833,233 I259T possibly damaging Het
Other mutations in Olfr502
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02260:Olfr502 APN 7 108523285 missense probably benign 0.00
R0007:Olfr502 UTSW 7 108523213 missense probably damaging 1.00
R0650:Olfr502 UTSW 7 108523082 missense probably damaging 1.00
R1448:Olfr502 UTSW 7 108523318 missense probably benign
R1469:Olfr502 UTSW 7 108523204 missense probably benign 0.14
R1469:Olfr502 UTSW 7 108523204 missense probably benign 0.14
R3736:Olfr502 UTSW 7 108523419 missense possibly damaging 0.79
R5030:Olfr502 UTSW 7 108523177 missense possibly damaging 0.66
R5315:Olfr502 UTSW 7 108523890 missense probably damaging 1.00
R6052:Olfr502 UTSW 7 108523738 missense probably benign 0.34
R6548:Olfr502 UTSW 7 108523216 missense probably benign 0.00
R6866:Olfr502 UTSW 7 108523170 missense probably damaging 0.96
R6946:Olfr502 UTSW 7 108523321 missense probably benign 0.02
R7582:Olfr502 UTSW 7 108523851 missense probably benign 0.00
Z1088:Olfr502 UTSW 7 108523398 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGTCACAATGATGATGGAGCCAGC -3'
(R):5'- TTTCCTGGAGGATGGGAACCACAC -3'

Sequencing Primer
(F):5'- CTGTGAATGAGGGAACAACTGC -3'
(R):5'- CAGATGACCCAGTCCTTAGAGTTG -3'
Posted On2014-05-14