Incidental Mutation 'R1701:Kctd1'
ID189757
Institutional Source Beutler Lab
Gene Symbol Kctd1
Ensembl Gene ENSMUSG00000036225
Gene Namepotassium channel tetramerisation domain containing 1
Synonyms
MMRRC Submission 039734-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1701 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location14968685-15151446 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 14969560 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 259 (I259L)
Ref Sequence ENSEMBL: ENSMUSP00000025992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025992] [ENSMUST00000168989]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025992
AA Change: I259L

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000025992
Gene: ENSMUSG00000036225
AA Change: I259L

DomainStartEndE-ValueType
BTB 38 140 5e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000168989
AA Change: I855L

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000128070
Gene: ENSMUSG00000036225
AA Change: I855L

DomainStartEndE-ValueType
low complexity region 14 44 N/A INTRINSIC
low complexity region 52 62 N/A INTRINSIC
low complexity region 70 101 N/A INTRINSIC
low complexity region 124 145 N/A INTRINSIC
low complexity region 217 234 N/A INTRINSIC
Pfam:DUF3504 278 435 2.6e-32 PFAM
low complexity region 482 503 N/A INTRINSIC
low complexity region 559 567 N/A INTRINSIC
BTB 634 736 5e-7 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl3 A G 4: 144,463,572 L53P probably damaging Het
Acadsb T A 7: 131,424,484 F19I probably benign Het
Aldh3a2 C T 11: 61,256,772 G303S probably damaging Het
Anks1b T C 10: 90,049,954 Y171H probably damaging Het
Anxa7 A T 14: 20,460,161 I385N probably damaging Het
Astn1 A T 1: 158,504,307 T324S possibly damaging Het
Ccdc88a T C 11: 29,477,427 V235A possibly damaging Het
Crhr2 T C 6: 55,099,270 K258R probably damaging Het
Ctnnd1 T C 2: 84,608,991 E786G probably damaging Het
Ctnnd2 G A 15: 30,921,981 D918N probably damaging Het
Dnah9 A G 11: 65,911,924 S200P probably damaging Het
Dot1l T C 10: 80,790,742 S1266P possibly damaging Het
Efemp1 A G 11: 28,921,750 T422A possibly damaging Het
Fam135b T C 15: 71,459,729 H1137R probably damaging Het
Flot2 C T 11: 78,049,547 S40L possibly damaging Het
Fras1 G A 5: 96,600,784 S706N probably benign Het
Gbf1 T C 19: 46,261,675 L357P probably damaging Het
Gm17689 A G 9: 36,581,818 probably benign Het
Gpatch2l A G 12: 86,288,952 S476G probably benign Het
Hbb-bh2 T C 7: 103,840,243 T34A probably benign Het
Ints8 A G 4: 11,231,656 L443P probably damaging Het
Intu T A 3: 40,664,264 D233E probably damaging Het
Lama5 A G 2: 180,221,369 C108R probably damaging Het
Lgals3bp T C 11: 118,393,955 Y266C probably damaging Het
Lrig2 T C 3: 104,494,677 I111V probably benign Het
Myh8 G T 11: 67,280,138 C125F probably damaging Het
Olfr1140 T A 2: 87,746,550 M118K probably damaging Het
Olfr203 T C 16: 59,303,288 I46T probably benign Het
Olfr502 T G 7: 108,523,524 Q142P probably benign Het
Olfr642 T C 7: 104,050,195 E53G possibly damaging Het
Olfr709-ps1 C A 7: 106,926,922 C179F probably damaging Het
Olfr771 T C 10: 129,160,105 Q293R probably damaging Het
Olfr90 C T 17: 37,085,731 V145M probably benign Het
Olfr967 A T 9: 39,751,069 I228F probably damaging Het
Phc2 C T 4: 128,751,607 P836S probably damaging Het
Pla2g7 T C 17: 43,600,524 F189S probably damaging Het
Ptprk A G 10: 28,466,058 D487G probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rad54l2 A G 9: 106,700,493 probably null Het
Robo4 G T 9: 37,403,443 V198L probably benign Het
Selenbp1 C A 3: 94,937,390 H119Q probably damaging Het
Slc25a13 T C 6: 6,152,525 probably null Het
Slc35f5 A G 1: 125,570,593 E176G possibly damaging Het
Soga1 T C 2: 157,030,619 N936S probably damaging Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Ssfa2 A G 2: 79,636,050 K75E probably damaging Het
Tenm4 G A 7: 96,902,889 V2512M probably damaging Het
Tmc8 A G 11: 117,791,362 probably null Het
Trim30d C T 7: 104,484,182 W21* probably null Het
Ube3c G A 5: 29,601,202 V281I probably benign Het
Usp17ld T C 7: 103,250,576 K383R probably benign Het
Vmn1r172 A T 7: 23,660,104 Y138F probably damaging Het
Vmn1r180 T C 7: 23,952,970 V186A possibly damaging Het
Vmn2r25 T A 6: 123,851,795 probably null Het
Vmn2r61 T C 7: 42,300,511 F785S probably damaging Het
Zfp141 T A 7: 42,476,046 Y334F probably benign Het
Zfp609 T C 9: 65,731,000 I317V probably benign Het
Zfp879 A G 11: 50,833,233 I259T possibly damaging Het
Other mutations in Kctd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01318:Kctd1 APN 18 15062690 missense possibly damaging 0.51
IGL01402:Kctd1 APN 18 14969553 missense probably damaging 0.98
IGL01404:Kctd1 APN 18 14969553 missense probably damaging 0.98
IGL01755:Kctd1 APN 18 15062637 missense possibly damaging 0.86
IGL02606:Kctd1 APN 18 15062880 missense possibly damaging 0.73
IGL02725:Kctd1 APN 18 14969610 missense possibly damaging 0.67
IGL02946:Kctd1 APN 18 14973979 critical splice donor site probably null
R0128:Kctd1 UTSW 18 14974180 missense probably benign 0.00
R0598:Kctd1 UTSW 18 15007765 missense probably damaging 1.00
R1398:Kctd1 UTSW 18 15062597 missense possibly damaging 0.85
R1669:Kctd1 UTSW 18 15062460 missense possibly damaging 0.71
R1745:Kctd1 UTSW 18 15063206 intron probably benign
R1779:Kctd1 UTSW 18 15061782 missense probably benign 0.01
R2083:Kctd1 UTSW 18 14974055 missense possibly damaging 0.89
R2389:Kctd1 UTSW 18 15062211 missense possibly damaging 0.73
R3010:Kctd1 UTSW 18 14974086 missense probably damaging 1.00
R4576:Kctd1 UTSW 18 15007700 missense probably damaging 1.00
R4673:Kctd1 UTSW 18 15063227 intron probably benign
R4884:Kctd1 UTSW 18 14974254 missense probably damaging 1.00
R4961:Kctd1 UTSW 18 15062523 missense probably damaging 0.97
R5169:Kctd1 UTSW 18 15062765 missense possibly damaging 0.72
R5398:Kctd1 UTSW 18 15062265 missense possibly damaging 0.86
R5695:Kctd1 UTSW 18 15063516 intron probably benign
R5893:Kctd1 UTSW 18 14969688 missense possibly damaging 0.93
R6175:Kctd1 UTSW 18 14969631 nonsense probably null
R6767:Kctd1 UTSW 18 15062175 missense possibly damaging 0.53
R6852:Kctd1 UTSW 18 14986344 missense possibly damaging 0.72
R6889:Kctd1 UTSW 18 14973988 missense probably damaging 1.00
R7189:Kctd1 UTSW 18 15062643 missense possibly damaging 0.71
R7228:Kctd1 UTSW 18 15062412 missense possibly damaging 0.95
R7688:Kctd1 UTSW 18 14974198 missense probably benign 0.03
Z1176:Kctd1 UTSW 18 15063125 missense unknown
Predicted Primers PCR Primer
(F):5'- AAGCAGTAAGGAGACTGTCCTCCC -3'
(R):5'- TCTATGCCTTGCCCCTAAGCAGAC -3'

Sequencing Primer
(F):5'- ctctctctctctctctctctctc -3'
(R):5'- CCTAAGCAGACGCCTATTTTG -3'
Posted On2014-05-14