Incidental Mutation 'R1701:Gbf1'
ID189758
Institutional Source Beutler Lab
Gene Symbol Gbf1
Ensembl Gene ENSMUSG00000025224
Gene Namegolgi-specific brefeldin A-resistance factor 1
Synonyms1700083E03Rik
MMRRC Submission 039734-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1701 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location46152509-46286510 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46261675 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 357 (L357P)
Ref Sequence ENSEMBL: ENSMUSP00000135062 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026254] [ENSMUST00000176992]
Predicted Effect probably damaging
Transcript: ENSMUST00000026254
AA Change: L411P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026254
Gene: ENSMUSG00000025224
AA Change: L411P

DomainStartEndE-ValueType
low complexity region 270 288 N/A INTRINSIC
Pfam:Sec7_N 400 551 3.4e-29 PFAM
Sec7 696 884 8.55e-91 SMART
low complexity region 1198 1216 N/A INTRINSIC
low complexity region 1281 1296 N/A INTRINSIC
low complexity region 1773 1793 N/A INTRINSIC
low complexity region 1802 1820 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130184
Predicted Effect probably benign
Transcript: ENSMUST00000176574
Predicted Effect probably damaging
Transcript: ENSMUST00000176992
AA Change: L357P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135062
Gene: ENSMUSG00000025224
AA Change: L357P

DomainStartEndE-ValueType
low complexity region 216 234 N/A INTRINSIC
Pfam:Sec7_N 343 498 1.5e-35 PFAM
Sec7 642 830 8.55e-91 SMART
low complexity region 1144 1162 N/A INTRINSIC
low complexity region 1227 1242 N/A INTRINSIC
low complexity region 1715 1735 N/A INTRINSIC
low complexity region 1744 1762 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177406
Predicted Effect probably benign
Transcript: ENSMUST00000177512
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Sec7 domain family. The encoded protein is a guanine nucleotide exchange factor that regulates the recruitment of proteins to membranes by mediating GDP to GTP exchange. The encoded protein is localized to the Golgi apparatus and plays a role in vesicular trafficking by activating ADP ribosylation factor 1. The encoded protein has also been identified as an important host factor for viral replication. Multiple transcript variants have been observed for this gene. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl3 A G 4: 144,463,572 L53P probably damaging Het
Acadsb T A 7: 131,424,484 F19I probably benign Het
Aldh3a2 C T 11: 61,256,772 G303S probably damaging Het
Anks1b T C 10: 90,049,954 Y171H probably damaging Het
Anxa7 A T 14: 20,460,161 I385N probably damaging Het
Astn1 A T 1: 158,504,307 T324S possibly damaging Het
Ccdc88a T C 11: 29,477,427 V235A possibly damaging Het
Crhr2 T C 6: 55,099,270 K258R probably damaging Het
Ctnnd1 T C 2: 84,608,991 E786G probably damaging Het
Ctnnd2 G A 15: 30,921,981 D918N probably damaging Het
Dnah9 A G 11: 65,911,924 S200P probably damaging Het
Dot1l T C 10: 80,790,742 S1266P possibly damaging Het
Efemp1 A G 11: 28,921,750 T422A possibly damaging Het
Fam135b T C 15: 71,459,729 H1137R probably damaging Het
Flot2 C T 11: 78,049,547 S40L possibly damaging Het
Fras1 G A 5: 96,600,784 S706N probably benign Het
Gm17689 A G 9: 36,581,818 probably benign Het
Gpatch2l A G 12: 86,288,952 S476G probably benign Het
Hbb-bh2 T C 7: 103,840,243 T34A probably benign Het
Ints8 A G 4: 11,231,656 L443P probably damaging Het
Intu T A 3: 40,664,264 D233E probably damaging Het
Kctd1 T A 18: 14,969,560 I259L possibly damaging Het
Lama5 A G 2: 180,221,369 C108R probably damaging Het
Lgals3bp T C 11: 118,393,955 Y266C probably damaging Het
Lrig2 T C 3: 104,494,677 I111V probably benign Het
Myh8 G T 11: 67,280,138 C125F probably damaging Het
Olfr1140 T A 2: 87,746,550 M118K probably damaging Het
Olfr203 T C 16: 59,303,288 I46T probably benign Het
Olfr502 T G 7: 108,523,524 Q142P probably benign Het
Olfr642 T C 7: 104,050,195 E53G possibly damaging Het
Olfr709-ps1 C A 7: 106,926,922 C179F probably damaging Het
Olfr771 T C 10: 129,160,105 Q293R probably damaging Het
Olfr90 C T 17: 37,085,731 V145M probably benign Het
Olfr967 A T 9: 39,751,069 I228F probably damaging Het
Phc2 C T 4: 128,751,607 P836S probably damaging Het
Pla2g7 T C 17: 43,600,524 F189S probably damaging Het
Ptprk A G 10: 28,466,058 D487G probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rad54l2 A G 9: 106,700,493 probably null Het
Robo4 G T 9: 37,403,443 V198L probably benign Het
Selenbp1 C A 3: 94,937,390 H119Q probably damaging Het
Slc25a13 T C 6: 6,152,525 probably null Het
Slc35f5 A G 1: 125,570,593 E176G possibly damaging Het
Soga1 T C 2: 157,030,619 N936S probably damaging Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Ssfa2 A G 2: 79,636,050 K75E probably damaging Het
Tenm4 G A 7: 96,902,889 V2512M probably damaging Het
Tmc8 A G 11: 117,791,362 probably null Het
Trim30d C T 7: 104,484,182 W21* probably null Het
Ube3c G A 5: 29,601,202 V281I probably benign Het
Usp17ld T C 7: 103,250,576 K383R probably benign Het
Vmn1r172 A T 7: 23,660,104 Y138F probably damaging Het
Vmn1r180 T C 7: 23,952,970 V186A possibly damaging Het
Vmn2r25 T A 6: 123,851,795 probably null Het
Vmn2r61 T C 7: 42,300,511 F785S probably damaging Het
Zfp141 T A 7: 42,476,046 Y334F probably benign Het
Zfp609 T C 9: 65,731,000 I317V probably benign Het
Zfp879 A G 11: 50,833,233 I259T possibly damaging Het
Other mutations in Gbf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Gbf1 APN 19 46284249 critical splice acceptor site probably null
IGL00988:Gbf1 APN 19 46284120 critical splice donor site probably null
IGL01352:Gbf1 APN 19 46265215 missense probably damaging 1.00
IGL01432:Gbf1 APN 19 46279995 missense probably damaging 1.00
IGL01469:Gbf1 APN 19 46279364 missense probably damaging 1.00
IGL01870:Gbf1 APN 19 46285669 missense probably benign 0.00
IGL02019:Gbf1 APN 19 46279292 missense possibly damaging 0.93
IGL02061:Gbf1 APN 19 46279258 missense possibly damaging 0.65
IGL02126:Gbf1 APN 19 46252117 missense probably damaging 0.97
IGL02272:Gbf1 APN 19 46269803 missense probably damaging 1.00
IGL02346:Gbf1 APN 19 46285930 missense probably damaging 1.00
IGL02491:Gbf1 APN 19 46262540 unclassified probably benign
IGL03003:Gbf1 APN 19 46255655 missense probably damaging 1.00
IGL03130:Gbf1 APN 19 46267348 missense possibly damaging 0.82
IGL03376:Gbf1 APN 19 46262521 missense possibly damaging 0.94
PIT4651001:Gbf1 UTSW 19 46163543 missense probably benign
R0107:Gbf1 UTSW 19 46284828 missense probably benign
R0139:Gbf1 UTSW 19 46261792 missense probably damaging 1.00
R0180:Gbf1 UTSW 19 46285722 missense probably benign
R0255:Gbf1 UTSW 19 46254110 splice site probably benign
R0317:Gbf1 UTSW 19 46254020 missense probably benign
R0329:Gbf1 UTSW 19 46272270 critical splice donor site probably null
R0372:Gbf1 UTSW 19 46285704 missense probably benign
R0666:Gbf1 UTSW 19 46262544 unclassified probably benign
R1463:Gbf1 UTSW 19 46271545 unclassified probably benign
R1848:Gbf1 UTSW 19 46272037 missense possibly damaging 0.90
R1962:Gbf1 UTSW 19 46267219 missense probably damaging 1.00
R1965:Gbf1 UTSW 19 46271564 missense probably damaging 1.00
R1966:Gbf1 UTSW 19 46271564 missense probably damaging 1.00
R2177:Gbf1 UTSW 19 46265670 missense probably benign
R2238:Gbf1 UTSW 19 46163618 missense probably benign
R2239:Gbf1 UTSW 19 46163618 missense probably benign
R2520:Gbf1 UTSW 19 46265367 missense probably benign
R3821:Gbf1 UTSW 19 46264807 missense probably damaging 0.99
R4681:Gbf1 UTSW 19 46280550 missense probably benign 0.41
R4695:Gbf1 UTSW 19 46259167 nonsense probably null
R4785:Gbf1 UTSW 19 46268395 missense possibly damaging 0.89
R5202:Gbf1 UTSW 19 46268454 missense probably benign 0.13
R5359:Gbf1 UTSW 19 46283725 critical splice donor site probably null
R5468:Gbf1 UTSW 19 46284296 missense possibly damaging 0.92
R5593:Gbf1 UTSW 19 46272524 missense possibly damaging 0.91
R5595:Gbf1 UTSW 19 46284422 missense possibly damaging 0.74
R5796:Gbf1 UTSW 19 46284343 missense probably benign 0.08
R5938:Gbf1 UTSW 19 46268452 missense probably damaging 1.00
R5957:Gbf1 UTSW 19 46246221 critical splice donor site probably null
R6059:Gbf1 UTSW 19 46265248 missense probably damaging 1.00
R6120:Gbf1 UTSW 19 46279321 missense possibly damaging 0.83
R6239:Gbf1 UTSW 19 46259696 missense probably benign 0.00
R6252:Gbf1 UTSW 19 46271556 missense probably benign 0.33
R6310:Gbf1 UTSW 19 46280005 missense probably damaging 0.96
R6787:Gbf1 UTSW 19 46271772 missense probably benign
R6805:Gbf1 UTSW 19 46262507 missense probably damaging 1.00
R6855:Gbf1 UTSW 19 46279941 missense probably benign 0.00
R7313:Gbf1 UTSW 19 46280354 missense possibly damaging 0.94
R7414:Gbf1 UTSW 19 46283358 nonsense probably null
R7646:Gbf1 UTSW 19 46283672 missense probably damaging 1.00
R7650:Gbf1 UTSW 19 46272539 missense probably damaging 1.00
R7789:Gbf1 UTSW 19 46254002 missense probably damaging 1.00
R7801:Gbf1 UTSW 19 46272643 missense probably benign 0.03
R8241:Gbf1 UTSW 19 46246137 missense probably damaging 1.00
Z1177:Gbf1 UTSW 19 46259142 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CGGGCACATACATTTGTACACCATACC -3'
(R):5'- AGCTTACTGAGCTTTTACTGTGGCTTC -3'

Sequencing Primer
(F):5'- TTTGTACACCATACCACACCTAC -3'
(R):5'- CCAACTTAAAGTGTGCAGGTC -3'
Posted On2014-05-14