Mutagenetix > Incidental Mutation

Incidental Mutation 'R1702:Trip12'

189761

Institutional Source

Beutler Lab

Gene Symbol

Trip12

Ensembl Gene

ENSMUSG00000026219

Gene Name

thyroid hormone receptor interactor 12

Synonyms

6720416K24Rik, 1110036I07Rik, Gtl6

MMRRC Submission

039735-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1702 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

84721189-84840516 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 84745063 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 127 (I127N)

Ref Sequence

ENSEMBL: ENSMUSP00000140789 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027421] [ENSMUST00000185909] [ENSMUST00000186465] [ENSMUST00000186648] [ENSMUST00000189670] [ENSMUST00000189841]

AlphaFold

G5E870

Predicted Effect

probably damaging
Transcript: ENSMUST00000027421
AA Change: I1322N

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000027421
Gene: ENSMUSG00000026219
AA Change: I1322N

Domain	Start	End	E-Value	Type
low complexity region	34	39	N/A	INTRINSIC
low complexity region	153	172	N/A	INTRINSIC
low complexity region	177	188	N/A	INTRINSIC
low complexity region	191	215	N/A	INTRINSIC
low complexity region	231	247	N/A	INTRINSIC
low complexity region	379	391	N/A	INTRINSIC
low complexity region	392	406	N/A	INTRINSIC
low complexity region	416	427	N/A	INTRINSIC
SCOP:d1ee4a_	446	660	5e-20	SMART
PDB:1WA5\|B	447	641	1e-5	PDB
Pfam:WWE	765	831	7.6e-22	PFAM
low complexity region	983	1006	N/A	INTRINSIC
low complexity region	1033	1047	N/A	INTRINSIC
low complexity region	1062	1073	N/A	INTRINSIC
low complexity region	1333	1344	N/A	INTRINSIC
low complexity region	1345	1362	N/A	INTRINSIC
Blast:HECTc	1363	1417	8e-8	BLAST
Blast:HECTc	1573	1629	2e-24	BLAST
HECTc	1636	2025	1.29e-177	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000185909

SMART Domains

Protein: ENSMUSP00000139986
Gene: ENSMUSG00000026219

Domain	Start	End	E-Value	Type
low complexity region	195	214	N/A	INTRINSIC
low complexity region	219	230	N/A	INTRINSIC
low complexity region	233	257	N/A	INTRINSIC
low complexity region	273	289	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000186465
AA Change: I1322N

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000140224
Gene: ENSMUSG00000026219
AA Change: I1322N

Domain	Start	End	E-Value	Type
low complexity region	34	39	N/A	INTRINSIC
low complexity region	153	172	N/A	INTRINSIC
low complexity region	177	188	N/A	INTRINSIC
low complexity region	191	215	N/A	INTRINSIC
low complexity region	231	247	N/A	INTRINSIC
low complexity region	379	391	N/A	INTRINSIC
low complexity region	392	406	N/A	INTRINSIC
low complexity region	416	427	N/A	INTRINSIC
SCOP:d1ee4a_	446	660	5e-20	SMART
PDB:1WA5\|B	447	641	1e-5	PDB
Pfam:WWE	761	831	2.2e-22	PFAM
low complexity region	983	1006	N/A	INTRINSIC
low complexity region	1033	1047	N/A	INTRINSIC
low complexity region	1062	1073	N/A	INTRINSIC
low complexity region	1333	1344	N/A	INTRINSIC
low complexity region	1345	1362	N/A	INTRINSIC
Blast:HECTc	1363	1417	8e-8	BLAST
Blast:HECTc	1573	1629	2e-24	BLAST
HECTc	1636	2025	1.29e-177	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000186648
AA Change: I1289N

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000139563
Gene: ENSMUSG00000026219
AA Change: I1289N

Domain	Start	End	E-Value	Type
low complexity region	34	39	N/A	INTRINSIC
low complexity region	153	172	N/A	INTRINSIC
low complexity region	177	188	N/A	INTRINSIC
low complexity region	191	215	N/A	INTRINSIC
low complexity region	231	247	N/A	INTRINSIC
low complexity region	386	400	N/A	INTRINSIC
low complexity region	410	421	N/A	INTRINSIC
SCOP:d1ee4a_	440	654	5e-20	SMART
PDB:1WA5\|B	441	635	1e-5	PDB
low complexity region	950	973	N/A	INTRINSIC
low complexity region	1000	1014	N/A	INTRINSIC
low complexity region	1029	1040	N/A	INTRINSIC
low complexity region	1300	1311	N/A	INTRINSIC
low complexity region	1312	1329	N/A	INTRINSIC
Blast:HECTc	1330	1384	7e-8	BLAST
Blast:HECTc	1540	1596	2e-24	BLAST
HECTc	1603	1992	6.2e-180	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000189670
AA Change: I127N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000140789
Gene: ENSMUSG00000026219
AA Change: I127N

Domain	Start	End	E-Value	Type
low complexity region	138	149	N/A	INTRINSIC
low complexity region	150	167	N/A	INTRINSIC
Blast:HECTc	168	222	5e-8	BLAST
Blast:HECTc	378	434	1e-24	BLAST
HECTc	441	830	6.2e-180	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000189841

SMART Domains

Protein: ENSMUSP00000140879
Gene: ENSMUSG00000026219

Domain	Start	End	E-Value	Type
low complexity region	1	24	N/A	INTRINSIC
low complexity region	51	63	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000190125

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 96.9%
20x: 94.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an E3 ubiquitin-protein ligase involved in the degradation of the p19ARF/ARF isoform of CDKN2A, a tumor suppressor. The encoded protein also plays a role in the DNA damage response by regulating the stability of USP7, which regulates tumor suppressor p53. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a targeted allele exhibit complete embryonic lethality during organogenesis associated with embryonic growth retardation and abnormal placenta development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	T	A	11: 78,289,028	C2126S	probably damaging	Het
Abca15	T	C	7: 120,382,702	V1080A	probably benign	Het
Abcg4	A	C	9: 44,275,073	V553G	probably damaging	Het
Ache	T	C	5: 137,290,989	V319A	possibly damaging	Het
Acsm2	T	A	7: 119,573,564	M134K	possibly damaging	Het
Ank2	A	T	3: 126,955,899	S494T	probably benign	Het
Asic3	A	T	5: 24,415,456	T202S	probably damaging	Het
Baiap3	T	A	17: 25,244,805	H886L	probably damaging	Het
Cidea	T	A	18: 67,366,421	I126K	probably damaging	Het
Cmklr1	T	G	5: 113,613,842	K366T	probably benign	Het
Cntrl	A	T	2: 35,171,836		probably null	Het
Crhr2	A	G	6: 55,092,535	F378S	probably damaging	Het
Deaf1	C	G	7: 141,314,954	R303T	probably damaging	Het
Dnah9	T	A	11: 66,085,195	N1343Y	possibly damaging	Het
Dopey2	A	G	16: 93,747,621	K99E	possibly damaging	Het
Dpp4	A	T	2: 62,386,429		probably null	Het
Dst	T	C	1: 34,167,340	V598A	probably damaging	Het
Ece2	C	T	16: 20,631,246	R136C	probably damaging	Het
Egf	C	A	3: 129,690,811	V453L	probably benign	Het
Egr3	T	A	14: 70,079,767	F342L	probably damaging	Het
Eif2ak2	A	T	17: 78,856,634	I434N	probably damaging	Het
Emc1	A	G	4: 139,375,201	T936A	probably damaging	Het
Fmod	A	T	1: 134,040,762	E180V	probably damaging	Het
Gabrg3	T	C	7: 56,985,100	T112A	probably damaging	Het
Gak	T	C	5: 108,606,376		probably null	Het
Gas2	T	A	7: 51,953,341		probably null	Het
Gm11639	C	T	11: 104,691,006	P58L	probably benign	Het
Gm2381	T	A	7: 42,820,231	Q156H	probably benign	Het
Golga2	T	A	2: 32,299,275	S273T	probably damaging	Het
Homez	T	A	14: 54,856,995	T419S	probably damaging	Het
Igfbp6	T	A	15: 102,148,182	Y184*	probably null	Het
Il11	A	G	7: 4,773,734	S86P	probably damaging	Het
Itgal	A	G	7: 127,305,025	N270S	probably benign	Het
Lama2	T	C	10: 27,190,529	R1119G	probably benign	Het
Lamp3	G	T	16: 19,676,072	N294K	probably benign	Het
Mars	T	C	10: 127,310,079	I113M	possibly damaging	Het
Mgat5b	A	G	11: 116,948,659	T334A	possibly damaging	Het
Mis18bp1	A	G	12: 65,161,744	I65T	probably benign	Het
Mmrn2	A	T	14: 34,397,914	N247I	probably benign	Het
Muc6	G	T	7: 141,650,487	N322K	probably damaging	Het
Mx2	A	G	16: 97,558,683	H551R	probably benign	Het
Mylk	T	A	16: 34,921,944	V942E	probably benign	Het
Nes	A	G	3: 87,975,979	E515G	probably benign	Het
Nfatc3	T	G	8: 106,092,160	S503R	probably damaging	Het
Nkain3	C	A	4: 20,158,339		probably null	Het
Noxa1	A	G	2: 25,092,584	V73A	probably damaging	Het
Nup160	A	T	2: 90,683,958	E83D	probably damaging	Het
Olfr1427	C	A	19: 12,099,166	V158L	probably benign	Het
Olfr205	C	A	16: 59,329,141	V123L	probably benign	Het
Olfr530	A	T	7: 140,372,742	Y289*	probably null	Het
Olfr923	A	G	9: 38,828,543	Y284C	probably damaging	Het
Plxnb2	A	G	15: 89,161,984		probably null	Het
Rundc3b	A	G	5: 8,512,318	V350A	probably benign	Het
Scn1a	C	T	2: 66,318,223	D993N	probably damaging	Het
Sec24c	G	T	14: 20,686,573	G226V	probably null	Het
Sept11	T	A	5: 93,156,924	I200N	probably damaging	Het
Shank3	G	T	15: 89,499,896	G14C	probably damaging	Het
Slc25a39	T	C	11: 102,406,626	D5G	possibly damaging	Het
Stoml3	A	T	3: 53,505,431	T169S	probably benign	Het
Taf1b	T	A	12: 24,509,126	I83K	possibly damaging	Het
Tarbp1	T	A	8: 126,428,218	Q1389L	probably damaging	Het
Thbs1	T	A	2: 118,113,442	D180E	probably benign	Het
Tmc5	T	A	7: 118,672,239	V925D	probably benign	Het
Tmem62	T	C	2: 120,979,227	V130A	probably damaging	Het
Tpp2	C	T	1: 43,990,548	P997L	probably damaging	Het
Ttc37	A	G	13: 76,122,743	K153R	possibly damaging	Het
Upp2	T	C	2: 58,771,550	F142L	possibly damaging	Het
Usf3	C	T	16: 44,219,632	Q1492*	probably null	Het
Vcp	T	C	4: 42,990,840	D205G	probably damaging	Het
Vmn1r180	G	A	7: 23,952,969	V186I	possibly damaging	Het
Washc2	T	C	6: 116,229,306	S496P	probably damaging	Het
Wee2	T	C	6: 40,464,201	I480T	probably benign	Het
Xylt2	T	A	11: 94,668,745	H357L	probably damaging	Het
Zbed4	T	C	15: 88,780,853	S375P	probably damaging	Het
Zfp442	A	T	2: 150,409,180	Y266*	probably null	Het
Zfp600	A	G	4: 146,196,927	T722A	probably benign	Het
Zfp976	T	A	7: 42,616,000	H55L	possibly damaging	Het

Other mutations in Trip12

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00331:Trip12	APN	1	84730541	missense	probably damaging	1.00
IGL00430:Trip12	APN	1	84763861	missense	probably damaging	0.96
IGL00465:Trip12	APN	1	84763861	missense	probably damaging	0.96
IGL00819:Trip12	APN	1	84754272	missense	probably damaging	1.00
IGL00900:Trip12	APN	1	84724764	missense	possibly damaging	0.56
IGL00990:Trip12	APN	1	84751884	missense	probably damaging	0.99
IGL01087:Trip12	APN	1	84757859	missense	probably damaging	0.99
IGL01400:Trip12	APN	1	84751978	missense	probably damaging	0.99
IGL01521:Trip12	APN	1	84766198	splice site	probably benign
IGL01619:Trip12	APN	1	84814910	missense	probably damaging	0.99
IGL01796:Trip12	APN	1	84728278	missense	probably benign	0.42
IGL01975:Trip12	APN	1	84814813	splice site	probably benign
IGL02190:Trip12	APN	1	84766070	missense	probably damaging	0.98
IGL02474:Trip12	APN	1	84794133	missense	probably benign
IGL02517:Trip12	APN	1	84743814	unclassified	probably benign
IGL02631:Trip12	APN	1	84766008	missense	possibly damaging	0.91
IGL02991:Trip12	APN	1	84738815	missense	probably damaging	1.00
IGL03161:Trip12	APN	1	84761132	unclassified	probably benign
IGL03388:Trip12	APN	1	84743186	missense	probably damaging	0.99
cardamom	UTSW	1	84749276	missense	probably damaging	0.99
pungent	UTSW	1	84793915	missense	possibly damaging	0.70
spices	UTSW	1	84793875	missense	probably benign	0.10
sulfuric	UTSW	1	84759050	missense	probably benign	0.19
Turmeric	UTSW	1	84754343	missense	probably benign	0.07
LCD18:Trip12	UTSW	1	84754482	unclassified	probably benign
R0090:Trip12	UTSW	1	84732136	splice site	probably benign
R0111:Trip12	UTSW	1	84759133	unclassified	probably benign
R0471:Trip12	UTSW	1	84726207	missense	probably damaging	1.00
R0486:Trip12	UTSW	1	84761084	nonsense	probably null
R0557:Trip12	UTSW	1	84724747	missense	probably damaging	1.00
R0570:Trip12	UTSW	1	84751548	missense	probably damaging	1.00
R0614:Trip12	UTSW	1	84757761	missense	probably damaging	1.00
R0627:Trip12	UTSW	1	84768597	missense	probably damaging	1.00
R0630:Trip12	UTSW	1	84793915	missense	possibly damaging	0.70
R0657:Trip12	UTSW	1	84759050	missense	probably benign	0.19
R0741:Trip12	UTSW	1	84745181	missense	probably benign	0.09
R0862:Trip12	UTSW	1	84744009	missense	probably damaging	0.99
R0864:Trip12	UTSW	1	84744009	missense	probably damaging	0.99
R1124:Trip12	UTSW	1	84737037	missense	probably damaging	1.00
R1252:Trip12	UTSW	1	84776350	nonsense	probably null
R1455:Trip12	UTSW	1	84759100	missense	probably benign	0.01
R1487:Trip12	UTSW	1	84768631	missense	probably damaging	1.00
R1781:Trip12	UTSW	1	84730621	missense	probably benign	0.01
R1847:Trip12	UTSW	1	84749269	missense	probably damaging	1.00
R1854:Trip12	UTSW	1	84728145	missense	probably damaging	1.00
R1866:Trip12	UTSW	1	84745060	missense	probably damaging	1.00
R1926:Trip12	UTSW	1	84749291	missense	probably damaging	0.98
R1935:Trip12	UTSW	1	84794101	missense	possibly damaging	0.46
R1950:Trip12	UTSW	1	84760801	missense	probably damaging	1.00
R1994:Trip12	UTSW	1	84749172	missense	probably damaging	1.00
R2014:Trip12	UTSW	1	84760866	nonsense	probably null
R2391:Trip12	UTSW	1	84814790	frame shift	probably null
R2423:Trip12	UTSW	1	84814790	frame shift	probably null
R2433:Trip12	UTSW	1	84743823	missense	possibly damaging	0.84
R2905:Trip12	UTSW	1	84754343	missense	probably benign	0.07
R3040:Trip12	UTSW	1	84742245	missense	probably benign	0.13
R3735:Trip12	UTSW	1	84814790	frame shift	probably null
R3907:Trip12	UTSW	1	84732106	missense	possibly damaging	0.53
R4394:Trip12	UTSW	1	84725741	missense	probably damaging	1.00
R4540:Trip12	UTSW	1	84749276	missense	probably damaging	0.99
R4859:Trip12	UTSW	1	84793810	missense	probably damaging	0.99
R5240:Trip12	UTSW	1	84794133	missense	probably benign
R5278:Trip12	UTSW	1	84762147	missense	probably damaging	1.00
R5377:Trip12	UTSW	1	84757431	missense	probably damaging	1.00
R5510:Trip12	UTSW	1	84768680	missense	probably damaging	1.00
R5542:Trip12	UTSW	1	84749344	missense	probably damaging	1.00
R5550:Trip12	UTSW	1	84761099	missense	probably damaging	0.99
R5886:Trip12	UTSW	1	84730458	intron	probably benign
R5893:Trip12	UTSW	1	84759163	unclassified	probably benign
R5914:Trip12	UTSW	1	84763458	missense	probably damaging	1.00
R5925:Trip12	UTSW	1	84749253	nonsense	probably null
R5985:Trip12	UTSW	1	84725771	missense	probably damaging	0.99
R6135:Trip12	UTSW	1	84760838	missense	probably benign	0.00
R6158:Trip12	UTSW	1	84761012	missense	possibly damaging	0.84
R6419:Trip12	UTSW	1	84793870	missense	probably damaging	1.00
R6816:Trip12	UTSW	1	84793714	missense	probably damaging	0.99
R7144:Trip12	UTSW	1	84793714	missense	probably damaging	0.99
R7194:Trip12	UTSW	1	84794222	missense	probably benign	0.07
R7355:Trip12	UTSW	1	84814883	missense	probably damaging	1.00
R7361:Trip12	UTSW	1	84750442	missense	probably damaging	0.98
R7588:Trip12	UTSW	1	84760883	missense	probably damaging	0.99
R7705:Trip12	UTSW	1	84777449	missense	probably damaging	1.00
R7818:Trip12	UTSW	1	84760806	missense	probably damaging	1.00
R7918:Trip12	UTSW	1	84745063	missense	probably damaging	0.98
R8127:Trip12	UTSW	1	84738742	missense	probably damaging	0.99
R8221:Trip12	UTSW	1	84766050	missense	possibly damaging	0.80
R8336:Trip12	UTSW	1	84766041	missense	probably benign	0.37
R8373:Trip12	UTSW	1	84795767	missense	probably damaging	0.98
R8719:Trip12	UTSW	1	84745069	missense	probably damaging	0.98
R8771:Trip12	UTSW	1	84743297	unclassified	probably benign
R8997:Trip12	UTSW	1	84793875	missense	probably benign	0.10
R9146:Trip12	UTSW	1	84794160	missense	possibly damaging	0.89
R9236:Trip12	UTSW	1	84725829	missense	probably damaging	1.00
R9338:Trip12	UTSW	1	84749298	missense	probably damaging	0.99
R9391:Trip12	UTSW	1	84795752	missense	probably benign	0.00
R9516:Trip12	UTSW	1	84757494	missense	probably damaging	1.00
X0023:Trip12	UTSW	1	84760787	missense	probably benign	0.12
X0065:Trip12	UTSW	1	84749163	missense	probably benign	0.21
Z1088:Trip12	UTSW	1	84766168	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGACCAGAGGTTCCTACAACCTAAAG -3'
(R):5'- GGTGAGTGTGCCCAGATAGTTGAAG -3'

Sequencing Primer
(F):5'- GAGGTTCCTACAACCTAAAGTTTATG -3'
(R):5'- CACAGTGGCTAGAGATCATGTTC -3'

Posted On

2014-05-14