Incidental Mutation 'R1702:Nup160'
ID189771
Institutional Source Beutler Lab
Gene Symbol Nup160
Ensembl Gene ENSMUSG00000051329
Gene Namenucleoporin 160
SynonymsGtl1-13, 2810011M03Rik
MMRRC Submission 039735-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.969) question?
Stock #R1702 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location90677215-90736328 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 90683958 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 83 (E83D)
Ref Sequence ENSEMBL: ENSMUSP00000059289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057481]
Predicted Effect probably damaging
Transcript: ENSMUST00000057481
AA Change: E83D

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000059289
Gene: ENSMUSG00000051329
AA Change: E83D

DomainStartEndE-ValueType
Pfam:Nup160 28 543 9.9e-134 PFAM
low complexity region 695 710 N/A INTRINSIC
low complexity region 1141 1152 N/A INTRINSIC
low complexity region 1302 1315 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154036
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NUP160 is 1 of up to 60 proteins that make up the 120-MD nuclear pore complex, which mediates nucleoplasmic transport.[supplied by OMIM, Apr 2004]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,289,028 C2126S probably damaging Het
Abca15 T C 7: 120,382,702 V1080A probably benign Het
Abcg4 A C 9: 44,275,073 V553G probably damaging Het
Ache T C 5: 137,290,989 V319A possibly damaging Het
Acsm2 T A 7: 119,573,564 M134K possibly damaging Het
Ank2 A T 3: 126,955,899 S494T probably benign Het
Asic3 A T 5: 24,415,456 T202S probably damaging Het
Baiap3 T A 17: 25,244,805 H886L probably damaging Het
Cidea T A 18: 67,366,421 I126K probably damaging Het
Cmklr1 T G 5: 113,613,842 K366T probably benign Het
Cntrl A T 2: 35,171,836 probably null Het
Crhr2 A G 6: 55,092,535 F378S probably damaging Het
Deaf1 C G 7: 141,314,954 R303T probably damaging Het
Dnah9 T A 11: 66,085,195 N1343Y possibly damaging Het
Dopey2 A G 16: 93,747,621 K99E possibly damaging Het
Dpp4 A T 2: 62,386,429 probably null Het
Dst T C 1: 34,167,340 V598A probably damaging Het
Ece2 C T 16: 20,631,246 R136C probably damaging Het
Egf C A 3: 129,690,811 V453L probably benign Het
Egr3 T A 14: 70,079,767 F342L probably damaging Het
Eif2ak2 A T 17: 78,856,634 I434N probably damaging Het
Emc1 A G 4: 139,375,201 T936A probably damaging Het
Fmod A T 1: 134,040,762 E180V probably damaging Het
Gabrg3 T C 7: 56,985,100 T112A probably damaging Het
Gak T C 5: 108,606,376 probably null Het
Gas2 T A 7: 51,953,341 probably null Het
Gm11639 C T 11: 104,691,006 P58L probably benign Het
Gm2381 T A 7: 42,820,231 Q156H probably benign Het
Golga2 T A 2: 32,299,275 S273T probably damaging Het
Homez T A 14: 54,856,995 T419S probably damaging Het
Igfbp6 T A 15: 102,148,182 Y184* probably null Het
Il11 A G 7: 4,773,734 S86P probably damaging Het
Itgal A G 7: 127,305,025 N270S probably benign Het
Lama2 T C 10: 27,190,529 R1119G probably benign Het
Lamp3 G T 16: 19,676,072 N294K probably benign Het
Mars T C 10: 127,310,079 I113M possibly damaging Het
Mgat5b A G 11: 116,948,659 T334A possibly damaging Het
Mis18bp1 A G 12: 65,161,744 I65T probably benign Het
Mmrn2 A T 14: 34,397,914 N247I probably benign Het
Muc6 G T 7: 141,650,487 N322K probably damaging Het
Mx2 A G 16: 97,558,683 H551R probably benign Het
Mylk T A 16: 34,921,944 V942E probably benign Het
Nes A G 3: 87,975,979 E515G probably benign Het
Nfatc3 T G 8: 106,092,160 S503R probably damaging Het
Nkain3 C A 4: 20,158,339 probably null Het
Noxa1 A G 2: 25,092,584 V73A probably damaging Het
Olfr1427 C A 19: 12,099,166 V158L probably benign Het
Olfr205 C A 16: 59,329,141 V123L probably benign Het
Olfr530 A T 7: 140,372,742 Y289* probably null Het
Olfr923 A G 9: 38,828,543 Y284C probably damaging Het
Plxnb2 A G 15: 89,161,984 probably null Het
Rundc3b A G 5: 8,512,318 V350A probably benign Het
Scn1a C T 2: 66,318,223 D993N probably damaging Het
Sec24c G T 14: 20,686,573 G226V probably null Het
Sept11 T A 5: 93,156,924 I200N probably damaging Het
Shank3 G T 15: 89,499,896 G14C probably damaging Het
Slc25a39 T C 11: 102,406,626 D5G possibly damaging Het
Stoml3 A T 3: 53,505,431 T169S probably benign Het
Taf1b T A 12: 24,509,126 I83K possibly damaging Het
Tarbp1 T A 8: 126,428,218 Q1389L probably damaging Het
Thbs1 T A 2: 118,113,442 D180E probably benign Het
Tmc5 T A 7: 118,672,239 V925D probably benign Het
Tmem62 T C 2: 120,979,227 V130A probably damaging Het
Tpp2 C T 1: 43,990,548 P997L probably damaging Het
Trip12 A T 1: 84,745,063 I127N probably damaging Het
Ttc37 A G 13: 76,122,743 K153R possibly damaging Het
Upp2 T C 2: 58,771,550 F142L possibly damaging Het
Usf3 C T 16: 44,219,632 Q1492* probably null Het
Vcp T C 4: 42,990,840 D205G probably damaging Het
Vmn1r180 G A 7: 23,952,969 V186I possibly damaging Het
Washc2 T C 6: 116,229,306 S496P probably damaging Het
Wee2 T C 6: 40,464,201 I480T probably benign Het
Xylt2 T A 11: 94,668,745 H357L probably damaging Het
Zbed4 T C 15: 88,780,853 S375P probably damaging Het
Zfp442 A T 2: 150,409,180 Y266* probably null Het
Zfp600 A G 4: 146,196,927 T722A probably benign Het
Zfp976 T A 7: 42,616,000 H55L possibly damaging Het
Other mutations in Nup160
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Nup160 APN 2 90693106 missense probably damaging 1.00
IGL00938:Nup160 APN 2 90732827 missense probably damaging 1.00
IGL01111:Nup160 APN 2 90733209 missense probably benign 0.00
IGL01140:Nup160 APN 2 90700565 missense possibly damaging 0.85
IGL01348:Nup160 APN 2 90700428 missense probably benign 0.05
IGL01361:Nup160 APN 2 90684012 nonsense probably null
IGL01595:Nup160 APN 2 90729737 missense probably damaging 1.00
IGL01791:Nup160 APN 2 90703853 missense probably damaging 1.00
IGL02058:Nup160 APN 2 90729707 missense probably damaging 1.00
IGL02147:Nup160 APN 2 90703941 missense probably benign 0.17
IGL02250:Nup160 APN 2 90708870 missense probably damaging 1.00
IGL02507:Nup160 APN 2 90729735 missense probably benign 0.08
IGL03108:Nup160 APN 2 90703825 missense probably benign
R0031:Nup160 UTSW 2 90717587 splice site probably null
R0365:Nup160 UTSW 2 90708844 missense probably benign 0.01
R0417:Nup160 UTSW 2 90735427 missense possibly damaging 0.93
R0781:Nup160 UTSW 2 90733219 splice site probably benign
R1037:Nup160 UTSW 2 90693902 missense probably damaging 1.00
R1110:Nup160 UTSW 2 90733219 splice site probably benign
R1459:Nup160 UTSW 2 90690150 missense probably damaging 1.00
R1468:Nup160 UTSW 2 90700543 missense probably benign
R1468:Nup160 UTSW 2 90700543 missense probably benign
R1478:Nup160 UTSW 2 90679399 start gained probably benign
R1565:Nup160 UTSW 2 90722061 missense possibly damaging 0.62
R1617:Nup160 UTSW 2 90679499 missense probably benign
R1647:Nup160 UTSW 2 90710088 missense probably damaging 0.99
R1648:Nup160 UTSW 2 90710088 missense probably damaging 0.99
R1719:Nup160 UTSW 2 90700436 nonsense probably null
R2448:Nup160 UTSW 2 90722057 missense probably damaging 1.00
R3775:Nup160 UTSW 2 90722076 missense probably benign
R3776:Nup160 UTSW 2 90722076 missense probably benign
R4600:Nup160 UTSW 2 90685197 critical splice donor site probably null
R4812:Nup160 UTSW 2 90725691 missense probably damaging 1.00
R5075:Nup160 UTSW 2 90700174 missense probably damaging 0.99
R5309:Nup160 UTSW 2 90732832 nonsense probably null
R5312:Nup160 UTSW 2 90732832 nonsense probably null
R5447:Nup160 UTSW 2 90725615 missense possibly damaging 0.82
R5682:Nup160 UTSW 2 90679811 missense probably benign 0.29
R5726:Nup160 UTSW 2 90717851 missense probably damaging 1.00
R5771:Nup160 UTSW 2 90723396 missense probably damaging 1.00
R5825:Nup160 UTSW 2 90679770 critical splice acceptor site probably null
R5851:Nup160 UTSW 2 90707038 missense probably benign
R5988:Nup160 UTSW 2 90689209 missense probably damaging 1.00
R6151:Nup160 UTSW 2 90690105 nonsense probably null
R6164:Nup160 UTSW 2 90717876 nonsense probably null
R6356:Nup160 UTSW 2 90711935 splice site probably null
R6379:Nup160 UTSW 2 90702409 nonsense probably null
R6519:Nup160 UTSW 2 90718217 missense probably damaging 0.99
R6755:Nup160 UTSW 2 90700456 missense probably damaging 1.00
R6989:Nup160 UTSW 2 90707020 missense probably benign 0.34
R7251:Nup160 UTSW 2 90700174 missense probably damaging 0.99
R7256:Nup160 UTSW 2 90723355 missense probably damaging 1.00
R7353:Nup160 UTSW 2 90703952 missense probably damaging 0.99
R7546:Nup160 UTSW 2 90685058 missense probably damaging 1.00
R7761:Nup160 UTSW 2 90703112 missense probably benign
R7768:Nup160 UTSW 2 90700116 missense probably damaging 1.00
R7959:Nup160 UTSW 2 90713895 critical splice donor site probably null
R8525:Nup160 UTSW 2 90718096 critical splice donor site probably null
R8726:Nup160 UTSW 2 90733201 missense possibly damaging 0.86
R8745:Nup160 UTSW 2 90700119 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GTGAAAAGACGAACCTTGGTATCTCCA -3'
(R):5'- CTGTACATACGGGAAGGGTGTGGTA -3'

Sequencing Primer
(F):5'- cagcacacaggaggcag -3'
(R):5'- AAGGGTGTGGTAAAATTAATCTGTG -3'
Posted On2014-05-14