Incidental Mutation 'R1702:Thbs1'
Institutional Source Beutler Lab
Gene Symbol Thbs1
Ensembl Gene ENSMUSG00000040152
Gene Namethrombospondin 1
SynonymsTSP-1, TSP1, tbsp1, Thbs-1
MMRRC Submission 039735-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1702 (G1)
Quality Score225
Status Not validated
Chromosomal Location118111876-118127133 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 118113442 bp
Amino Acid Change Aspartic acid to Glutamic Acid at position 180 (D180E)
Ref Sequence ENSEMBL: ENSMUSP00000044903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039559]
Predicted Effect probably benign
Transcript: ENSMUST00000039559
AA Change: D180E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000044903
Gene: ENSMUSG00000040152
AA Change: D180E

signal peptide 1 18 N/A INTRINSIC
TSPN 24 221 2.68e-60 SMART
low complexity region 237 249 N/A INTRINSIC
coiled coil region 292 315 N/A INTRINSIC
VWC 319 373 3.6e-20 SMART
TSP1 383 430 4.21e-12 SMART
TSP1 439 491 3.04e-18 SMART
TSP1 496 548 8.6e-18 SMART
EGF 551 588 3.88e-3 SMART
EGF 592 646 1.69e1 SMART
EGF 650 691 7.13e-2 SMART
Pfam:TSP_3 728 763 5.8e-12 PFAM
Pfam:TSP_3 763 786 2.1e-5 PFAM
Pfam:TSP_3 787 822 3.3e-13 PFAM
Pfam:TSP_3 822 845 1.1e-6 PFAM
Pfam:TSP_3 846 883 2e-15 PFAM
Pfam:TSP_3 884 919 8.3e-13 PFAM
Pfam:TSP_3 920 954 4.9e-10 PFAM
Pfam:TSP_C 973 1170 1.4e-99 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138764
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148587
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a subunit of a disulfide-linked homotrimeric protein. This protein is an adhesive glycoprotein that mediates cell-to-cell and cell-to-matrix interactions. This protein can bind to fibrinogen, fibronectin, laminin, type V collagen and integrins alpha-V/beta-1. This protein has been shown to play roles in platelet aggregation, angiogenesis, and tumorigenesis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null mice show partial prenatal lethality, lordosis, kyphosis, leukocytosis, multiorgan inflammation, lung hemorrhage, pneumonia, resistance to radiation and ischemic injury, altered blood pressure and vasoactive stress responses, eye pathology, and corneal and lacrimal gland dysfunction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,289,028 C2126S probably damaging Het
Abca15 T C 7: 120,382,702 V1080A probably benign Het
Abcg4 A C 9: 44,275,073 V553G probably damaging Het
Ache T C 5: 137,290,989 V319A possibly damaging Het
Acsm2 T A 7: 119,573,564 M134K possibly damaging Het
Ank2 A T 3: 126,955,899 S494T probably benign Het
Asic3 A T 5: 24,415,456 T202S probably damaging Het
Baiap3 T A 17: 25,244,805 H886L probably damaging Het
Cidea T A 18: 67,366,421 I126K probably damaging Het
Cmklr1 T G 5: 113,613,842 K366T probably benign Het
Cntrl A T 2: 35,171,836 probably null Het
Crhr2 A G 6: 55,092,535 F378S probably damaging Het
Deaf1 C G 7: 141,314,954 R303T probably damaging Het
Dnah9 T A 11: 66,085,195 N1343Y possibly damaging Het
Dopey2 A G 16: 93,747,621 K99E possibly damaging Het
Dpp4 A T 2: 62,386,429 probably null Het
Dst T C 1: 34,167,340 V598A probably damaging Het
Ece2 C T 16: 20,631,246 R136C probably damaging Het
Egf C A 3: 129,690,811 V453L probably benign Het
Egr3 T A 14: 70,079,767 F342L probably damaging Het
Eif2ak2 A T 17: 78,856,634 I434N probably damaging Het
Emc1 A G 4: 139,375,201 T936A probably damaging Het
Fmod A T 1: 134,040,762 E180V probably damaging Het
Gabrg3 T C 7: 56,985,100 T112A probably damaging Het
Gak T C 5: 108,606,376 probably null Het
Gas2 T A 7: 51,953,341 probably null Het
Gm11639 C T 11: 104,691,006 P58L probably benign Het
Gm2381 T A 7: 42,820,231 Q156H probably benign Het
Golga2 T A 2: 32,299,275 S273T probably damaging Het
Homez T A 14: 54,856,995 T419S probably damaging Het
Igfbp6 T A 15: 102,148,182 Y184* probably null Het
Il11 A G 7: 4,773,734 S86P probably damaging Het
Itgal A G 7: 127,305,025 N270S probably benign Het
Lama2 T C 10: 27,190,529 R1119G probably benign Het
Lamp3 G T 16: 19,676,072 N294K probably benign Het
Mars T C 10: 127,310,079 I113M possibly damaging Het
Mgat5b A G 11: 116,948,659 T334A possibly damaging Het
Mis18bp1 A G 12: 65,161,744 I65T probably benign Het
Mmrn2 A T 14: 34,397,914 N247I probably benign Het
Muc6 G T 7: 141,650,487 N322K probably damaging Het
Mx2 A G 16: 97,558,683 H551R probably benign Het
Mylk T A 16: 34,921,944 V942E probably benign Het
Nes A G 3: 87,975,979 E515G probably benign Het
Nfatc3 T G 8: 106,092,160 S503R probably damaging Het
Nkain3 C A 4: 20,158,339 probably null Het
Noxa1 A G 2: 25,092,584 V73A probably damaging Het
Nup160 A T 2: 90,683,958 E83D probably damaging Het
Olfr1427 C A 19: 12,099,166 V158L probably benign Het
Olfr205 C A 16: 59,329,141 V123L probably benign Het
Olfr530 A T 7: 140,372,742 Y289* probably null Het
Olfr923 A G 9: 38,828,543 Y284C probably damaging Het
Plxnb2 A G 15: 89,161,984 probably null Het
Rundc3b A G 5: 8,512,318 V350A probably benign Het
Scn1a C T 2: 66,318,223 D993N probably damaging Het
Sec24c G T 14: 20,686,573 G226V probably null Het
Sept11 T A 5: 93,156,924 I200N probably damaging Het
Shank3 G T 15: 89,499,896 G14C probably damaging Het
Slc25a39 T C 11: 102,406,626 D5G possibly damaging Het
Stoml3 A T 3: 53,505,431 T169S probably benign Het
Taf1b T A 12: 24,509,126 I83K possibly damaging Het
Tarbp1 T A 8: 126,428,218 Q1389L probably damaging Het
Tmc5 T A 7: 118,672,239 V925D probably benign Het
Tmem62 T C 2: 120,979,227 V130A probably damaging Het
Tpp2 C T 1: 43,990,548 P997L probably damaging Het
Trip12 A T 1: 84,745,063 I127N probably damaging Het
Ttc37 A G 13: 76,122,743 K153R possibly damaging Het
Upp2 T C 2: 58,771,550 F142L possibly damaging Het
Usf3 C T 16: 44,219,632 Q1492* probably null Het
Vcp T C 4: 42,990,840 D205G probably damaging Het
Vmn1r180 G A 7: 23,952,969 V186I possibly damaging Het
Washc2 T C 6: 116,229,306 S496P probably damaging Het
Wee2 T C 6: 40,464,201 I480T probably benign Het
Xylt2 T A 11: 94,668,745 H357L probably damaging Het
Zbed4 T C 15: 88,780,853 S375P probably damaging Het
Zfp442 A T 2: 150,409,180 Y266* probably null Het
Zfp600 A G 4: 146,196,927 T722A probably benign Het
Zfp976 T A 7: 42,616,000 H55L possibly damaging Het
Other mutations in Thbs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:Thbs1 APN 2 118122973 missense probably damaging 1.00
IGL00920:Thbs1 APN 2 118113201 missense probably damaging 0.99
IGL01295:Thbs1 APN 2 118118327 missense possibly damaging 0.88
IGL01649:Thbs1 APN 2 118114982 missense probably benign
IGL02077:Thbs1 APN 2 118113110 missense probably benign 0.00
IGL02251:Thbs1 APN 2 118113518 missense probably benign 0.00
IGL02263:Thbs1 APN 2 118119880 missense probably benign 0.06
IGL02392:Thbs1 APN 2 118114660 missense probably benign
IGL02393:Thbs1 APN 2 118123099 missense possibly damaging 0.87
IGL02411:Thbs1 APN 2 118114970 missense probably benign
IGL02659:Thbs1 APN 2 118114792 missense probably benign 0.29
Stark UTSW 2 118121237 critical splice donor site probably null
R0014:Thbs1 UTSW 2 118113350 missense possibly damaging 0.51
R0042:Thbs1 UTSW 2 118122877 missense probably damaging 1.00
R0064:Thbs1 UTSW 2 118123914 critical splice acceptor site probably null
R0240:Thbs1 UTSW 2 118114393 missense probably damaging 1.00
R0240:Thbs1 UTSW 2 118114393 missense probably damaging 1.00
R0316:Thbs1 UTSW 2 118117574 missense probably damaging 1.00
R0393:Thbs1 UTSW 2 118112991 missense possibly damaging 0.69
R0678:Thbs1 UTSW 2 118122906 missense probably damaging 1.00
R1037:Thbs1 UTSW 2 118123051 missense probably damaging 1.00
R1440:Thbs1 UTSW 2 118114355 missense probably damaging 1.00
R1454:Thbs1 UTSW 2 118122672 missense probably damaging 1.00
R1571:Thbs1 UTSW 2 118119197 missense probably damaging 0.99
R2035:Thbs1 UTSW 2 118118340 critical splice donor site probably null
R2068:Thbs1 UTSW 2 118123537 nonsense probably null
R2171:Thbs1 UTSW 2 118122579 missense probably damaging 1.00
R2844:Thbs1 UTSW 2 118117628 missense probably benign 0.00
R2870:Thbs1 UTSW 2 118119378 missense probably damaging 1.00
R2870:Thbs1 UTSW 2 118119378 missense probably damaging 1.00
R3620:Thbs1 UTSW 2 118121159 missense probably benign 0.05
R3621:Thbs1 UTSW 2 118121159 missense probably benign 0.05
R3726:Thbs1 UTSW 2 118114710 missense probably benign 0.02
R4499:Thbs1 UTSW 2 118119950 missense possibly damaging 0.82
R4524:Thbs1 UTSW 2 118122979 missense probably damaging 1.00
R4576:Thbs1 UTSW 2 118119416 missense probably damaging 0.97
R4596:Thbs1 UTSW 2 118114755 missense possibly damaging 0.80
R4646:Thbs1 UTSW 2 118118329 missense probably benign 0.15
R4783:Thbs1 UTSW 2 118114792 missense probably benign 0.04
R4836:Thbs1 UTSW 2 118115018 missense possibly damaging 0.91
R4943:Thbs1 UTSW 2 118113449 missense probably damaging 1.00
R4967:Thbs1 UTSW 2 118114778 missense probably benign
R5014:Thbs1 UTSW 2 118120037 critical splice donor site probably null
R5062:Thbs1 UTSW 2 118121237 critical splice donor site probably null
R5363:Thbs1 UTSW 2 118122666 missense probably damaging 1.00
R5420:Thbs1 UTSW 2 118113155 missense possibly damaging 0.83
R5432:Thbs1 UTSW 2 118114683 missense probably benign 0.25
R5788:Thbs1 UTSW 2 118122508 missense probably damaging 1.00
R6221:Thbs1 UTSW 2 118119997 missense probably damaging 1.00
R6327:Thbs1 UTSW 2 118112656 missense unknown
R6466:Thbs1 UTSW 2 118119847 missense probably damaging 1.00
R6480:Thbs1 UTSW 2 118119117 missense probably damaging 1.00
R6794:Thbs1 UTSW 2 118120038 splice site probably null
R6983:Thbs1 UTSW 2 118119952 missense probably damaging 1.00
R7284:Thbs1 UTSW 2 118119356 missense probably damaging 1.00
R7320:Thbs1 UTSW 2 118114957 missense possibly damaging 0.80
R7467:Thbs1 UTSW 2 118118200 missense probably damaging 1.00
R7542:Thbs1 UTSW 2 118121174 missense probably damaging 1.00
R7552:Thbs1 UTSW 2 118113362 missense possibly damaging 0.90
R7575:Thbs1 UTSW 2 118122928 missense probably damaging 1.00
R7870:Thbs1 UTSW 2 118115027 missense possibly damaging 0.46
R7953:Thbs1 UTSW 2 118115027 missense possibly damaging 0.46
RF039:Thbs1 UTSW 2 118122865 critical splice acceptor site probably benign
RF054:Thbs1 UTSW 2 118122865 critical splice acceptor site probably benign
X0019:Thbs1 UTSW 2 118112982 missense probably damaging 1.00
Z1176:Thbs1 UTSW 2 118113479 missense probably benign 0.34
Z1176:Thbs1 UTSW 2 118120977 missense probably benign 0.25
Z1176:Thbs1 UTSW 2 118122922 missense probably damaging 1.00
Z1177:Thbs1 UTSW 2 118117658 critical splice donor site probably null
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- cctggcaccattacaacttatttc -3'
Posted On2014-05-14