Incidental Mutation 'R1702:Lamp3'
ID189837
Institutional Source Beutler Lab
Gene Symbol Lamp3
Ensembl Gene ENSMUSG00000041247
Gene Namelysosomal-associated membrane protein 3
SynonymsCd208, DC-LAMP, 1200002D17Rik, TSC403
MMRRC Submission 039735-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1702 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location19653378-19706375 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 19676072 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 294 (N294K)
Ref Sequence ENSEMBL: ENSMUSP00000080556 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081880]
Predicted Effect probably benign
Transcript: ENSMUST00000081880
AA Change: N294K

PolyPhen 2 Score 0.108 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000080556
Gene: ENSMUSG00000041247
AA Change: N294K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Lamp 103 411 5.6e-75 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dendritic cells (DCs) are the most potent antigen-presenting cells. Immature DCs efficiently capture antigens and differentiate into interdigitating dendritic cells (IDCs) in lymphoid tissues that induce primary T-cell responses (summary by de Saint-Vis et al., 1998 [PubMed 9768752]).[supplied by OMIM, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,289,028 C2126S probably damaging Het
Abca15 T C 7: 120,382,702 V1080A probably benign Het
Abcg4 A C 9: 44,275,073 V553G probably damaging Het
Ache T C 5: 137,290,989 V319A possibly damaging Het
Acsm2 T A 7: 119,573,564 M134K possibly damaging Het
Ank2 A T 3: 126,955,899 S494T probably benign Het
Asic3 A T 5: 24,415,456 T202S probably damaging Het
Baiap3 T A 17: 25,244,805 H886L probably damaging Het
Cidea T A 18: 67,366,421 I126K probably damaging Het
Cmklr1 T G 5: 113,613,842 K366T probably benign Het
Cntrl A T 2: 35,171,836 probably null Het
Crhr2 A G 6: 55,092,535 F378S probably damaging Het
Deaf1 C G 7: 141,314,954 R303T probably damaging Het
Dnah9 T A 11: 66,085,195 N1343Y possibly damaging Het
Dopey2 A G 16: 93,747,621 K99E possibly damaging Het
Dpp4 A T 2: 62,386,429 probably null Het
Dst T C 1: 34,167,340 V598A probably damaging Het
Ece2 C T 16: 20,631,246 R136C probably damaging Het
Egf C A 3: 129,690,811 V453L probably benign Het
Egr3 T A 14: 70,079,767 F342L probably damaging Het
Eif2ak2 A T 17: 78,856,634 I434N probably damaging Het
Emc1 A G 4: 139,375,201 T936A probably damaging Het
Fmod A T 1: 134,040,762 E180V probably damaging Het
Gabrg3 T C 7: 56,985,100 T112A probably damaging Het
Gak T C 5: 108,606,376 probably null Het
Gas2 T A 7: 51,953,341 probably null Het
Gm11639 C T 11: 104,691,006 P58L probably benign Het
Gm2381 T A 7: 42,820,231 Q156H probably benign Het
Golga2 T A 2: 32,299,275 S273T probably damaging Het
Homez T A 14: 54,856,995 T419S probably damaging Het
Igfbp6 T A 15: 102,148,182 Y184* probably null Het
Il11 A G 7: 4,773,734 S86P probably damaging Het
Itgal A G 7: 127,305,025 N270S probably benign Het
Lama2 T C 10: 27,190,529 R1119G probably benign Het
Mars T C 10: 127,310,079 I113M possibly damaging Het
Mgat5b A G 11: 116,948,659 T334A possibly damaging Het
Mis18bp1 A G 12: 65,161,744 I65T probably benign Het
Mmrn2 A T 14: 34,397,914 N247I probably benign Het
Muc6 G T 7: 141,650,487 N322K probably damaging Het
Mx2 A G 16: 97,558,683 H551R probably benign Het
Mylk T A 16: 34,921,944 V942E probably benign Het
Nes A G 3: 87,975,979 E515G probably benign Het
Nfatc3 T G 8: 106,092,160 S503R probably damaging Het
Nkain3 C A 4: 20,158,339 probably null Het
Noxa1 A G 2: 25,092,584 V73A probably damaging Het
Nup160 A T 2: 90,683,958 E83D probably damaging Het
Olfr1427 C A 19: 12,099,166 V158L probably benign Het
Olfr205 C A 16: 59,329,141 V123L probably benign Het
Olfr530 A T 7: 140,372,742 Y289* probably null Het
Olfr923 A G 9: 38,828,543 Y284C probably damaging Het
Plxnb2 A G 15: 89,161,984 probably null Het
Rundc3b A G 5: 8,512,318 V350A probably benign Het
Scn1a C T 2: 66,318,223 D993N probably damaging Het
Sec24c G T 14: 20,686,573 G226V probably null Het
Sept11 T A 5: 93,156,924 I200N probably damaging Het
Shank3 G T 15: 89,499,896 G14C probably damaging Het
Slc25a39 T C 11: 102,406,626 D5G possibly damaging Het
Stoml3 A T 3: 53,505,431 T169S probably benign Het
Taf1b T A 12: 24,509,126 I83K possibly damaging Het
Tarbp1 T A 8: 126,428,218 Q1389L probably damaging Het
Thbs1 T A 2: 118,113,442 D180E probably benign Het
Tmc5 T A 7: 118,672,239 V925D probably benign Het
Tmem62 T C 2: 120,979,227 V130A probably damaging Het
Tpp2 C T 1: 43,990,548 P997L probably damaging Het
Trip12 A T 1: 84,745,063 I127N probably damaging Het
Ttc37 A G 13: 76,122,743 K153R possibly damaging Het
Upp2 T C 2: 58,771,550 F142L possibly damaging Het
Usf3 C T 16: 44,219,632 Q1492* probably null Het
Vcp T C 4: 42,990,840 D205G probably damaging Het
Vmn1r180 G A 7: 23,952,969 V186I possibly damaging Het
Washc2 T C 6: 116,229,306 S496P probably damaging Het
Wee2 T C 6: 40,464,201 I480T probably benign Het
Xylt2 T A 11: 94,668,745 H357L probably damaging Het
Zbed4 T C 15: 88,780,853 S375P probably damaging Het
Zfp442 A T 2: 150,409,180 Y266* probably null Het
Zfp600 A G 4: 146,196,927 T722A probably benign Het
Zfp976 T A 7: 42,616,000 H55L possibly damaging Het
Other mutations in Lamp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01901:Lamp3 APN 16 19673419 missense probably damaging 1.00
IGL02505:Lamp3 APN 16 19655457 missense possibly damaging 0.48
IGL02892:Lamp3 APN 16 19676052 missense probably damaging 1.00
IGL03228:Lamp3 APN 16 19676067 missense possibly damaging 0.94
PIT4453001:Lamp3 UTSW 16 19673460 missense probably benign 0.14
R0295:Lamp3 UTSW 16 19701108 nonsense probably null
R0419:Lamp3 UTSW 16 19673552 missense probably damaging 1.00
R1568:Lamp3 UTSW 16 19673525 missense probably damaging 1.00
R2018:Lamp3 UTSW 16 19701211 missense probably benign 0.02
R2019:Lamp3 UTSW 16 19701211 missense probably benign 0.02
R4072:Lamp3 UTSW 16 19700716 missense possibly damaging 0.89
R4073:Lamp3 UTSW 16 19700716 missense possibly damaging 0.89
R4075:Lamp3 UTSW 16 19700716 missense possibly damaging 0.89
R4076:Lamp3 UTSW 16 19700716 missense possibly damaging 0.89
R4333:Lamp3 UTSW 16 19673436 missense probably benign 0.02
R4457:Lamp3 UTSW 16 19673529 missense probably benign 0.19
R4868:Lamp3 UTSW 16 19701290 missense probably benign 0.01
R4876:Lamp3 UTSW 16 19655470 missense probably damaging 0.97
R5766:Lamp3 UTSW 16 19701317 missense probably damaging 0.99
R5832:Lamp3 UTSW 16 19701320 missense probably damaging 0.98
R5997:Lamp3 UTSW 16 19701028 missense probably benign 0.22
R6000:Lamp3 UTSW 16 19700948 missense possibly damaging 0.88
R6088:Lamp3 UTSW 16 19673398 missense probably damaging 1.00
R6332:Lamp3 UTSW 16 19699681 missense probably damaging 1.00
R6636:Lamp3 UTSW 16 19701233 missense probably benign
R6637:Lamp3 UTSW 16 19701233 missense probably benign
R6881:Lamp3 UTSW 16 19699618 missense probably benign 0.39
R6966:Lamp3 UTSW 16 19699653 nonsense probably null
R7002:Lamp3 UTSW 16 19655422 missense possibly damaging 0.89
R7067:Lamp3 UTSW 16 19699663 missense probably damaging 0.99
R7425:Lamp3 UTSW 16 19699612 critical splice donor site probably null
R7781:Lamp3 UTSW 16 19699690 missense possibly damaging 0.86
R7866:Lamp3 UTSW 16 19699740 missense probably benign 0.01
R7894:Lamp3 UTSW 16 19655391 missense probably damaging 1.00
R7912:Lamp3 UTSW 16 19655497 missense probably damaging 1.00
R7949:Lamp3 UTSW 16 19699740 missense probably benign 0.01
R7977:Lamp3 UTSW 16 19655391 missense probably damaging 1.00
R7993:Lamp3 UTSW 16 19655497 missense probably damaging 1.00
R8036:Lamp3 UTSW 16 19701059 missense probably damaging 1.00
RF018:Lamp3 UTSW 16 19701250 missense probably benign
X0025:Lamp3 UTSW 16 19701056 missense possibly damaging 0.82
X0063:Lamp3 UTSW 16 19700885 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GACCAGCTTGGGTATTATGGCTAACAC -3'
(R):5'- GATGAGTCCTTCAAACTCCACCCTG -3'

Sequencing Primer
(F):5'- GTACACACAGATTTTGAATTCCCC -3'
(R):5'- CTTGGTAGAACTGAAATTCTCCTGG -3'
Posted On2014-05-14