Incidental Mutation 'R1702:Mylk'
ID 189839
Institutional Source Beutler Lab
Gene Symbol Mylk
Ensembl Gene ENSMUSG00000022836
Gene Name myosin, light polypeptide kinase
Synonyms Mlck, telokin, nmMlck, 9530072E15Rik, A930019C19Rik, MLCK108, MLCK210
MMRRC Submission 039735-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1702 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 34565580-34822790 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 34742314 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 942 (V942E)
Ref Sequence ENSEMBL: ENSMUSP00000023538 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023538]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000023538
AA Change: V942E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000023538
Gene: ENSMUSG00000022836
AA Change: V942E

DomainStartEndE-ValueType
IGc2 54 122 9.05e-11 SMART
IGc2 177 244 3.94e-11 SMART
Pfam:23ISL 255 409 3.6e-60 PFAM
IGc2 423 491 1.55e-9 SMART
IGc2 523 587 3.32e-18 SMART
IGc2 632 699 6.02e-7 SMART
IGc2 730 798 1.36e-5 SMART
low complexity region 827 844 N/A INTRINSIC
IGc2 1141 1208 2.42e-11 SMART
low complexity region 1251 1269 N/A INTRINSIC
IG 1275 1359 4.56e-7 SMART
FN3 1362 1444 2.33e-11 SMART
low complexity region 1457 1479 N/A INTRINSIC
S_TKc 1495 1750 4.23e-95 SMART
IGc2 1852 1920 5.92e-15 SMART
low complexity region 1934 1950 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232482
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, a muscle member of the immunoglobulin gene superfamily, encodes myosin light chain kinase which is a calcium/calmodulin dependent enzyme. This kinase phosphorylates myosin regulatory light chains to facilitate myosin interaction with actin filaments to produce contractile activity. This gene encodes both smooth muscle and nonmuscle isoforms. In addition, using a separate promoter in an intron in the 3' region, it encodes telokin, a small protein identical in sequence to the C-terminus of myosin light chain kinase, that is independently expressed in smooth muscle and functions to stabilize unphosphorylated myosin filaments. A pseudogene is located on the p arm of chromosome 3. Four transcript variants that produce four isoforms of the calcium/calmodulin dependent enzyme have been identified as well as two transcripts that produce two isoforms of telokin. Additional variants have been identified but lack full length transcripts. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice that lack the isoform abundant in endothelial cells show a reduced susceptibility to acute lung injury. Mice lacking the smooth muscle isoform exhibit partial pre- or neonatal lethality, short small intestine and impaired smooth muscle contraction in the colon. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T C 7: 119,981,925 (GRCm39) V1080A probably benign Het
Abcg4 A C 9: 44,186,370 (GRCm39) V553G probably damaging Het
Ache T C 5: 137,289,251 (GRCm39) V319A possibly damaging Het
Acsm2 T A 7: 119,172,787 (GRCm39) M134K possibly damaging Het
Ank2 A T 3: 126,749,548 (GRCm39) S494T probably benign Het
Asic3 A T 5: 24,620,454 (GRCm39) T202S probably damaging Het
Baiap3 T A 17: 25,463,779 (GRCm39) H886L probably damaging Het
Bltp2 T A 11: 78,179,854 (GRCm39) C2126S probably damaging Het
Cidea T A 18: 67,499,491 (GRCm39) I126K probably damaging Het
Cmklr1 T G 5: 113,751,903 (GRCm39) K366T probably benign Het
Cntrl A T 2: 35,061,848 (GRCm39) probably null Het
Crhr2 A G 6: 55,069,520 (GRCm39) F378S probably damaging Het
Deaf1 C G 7: 140,894,867 (GRCm39) R303T probably damaging Het
Dnah9 T A 11: 65,976,021 (GRCm39) N1343Y possibly damaging Het
Dop1b A G 16: 93,544,509 (GRCm39) K99E possibly damaging Het
Dpp4 A T 2: 62,216,773 (GRCm39) probably null Het
Dst T C 1: 34,206,421 (GRCm39) V598A probably damaging Het
Ece2 C T 16: 20,449,996 (GRCm39) R136C probably damaging Het
Efcab3 C T 11: 104,581,832 (GRCm39) P58L probably benign Het
Egf C A 3: 129,484,460 (GRCm39) V453L probably benign Het
Egr3 T A 14: 70,317,216 (GRCm39) F342L probably damaging Het
Eif2ak2 A T 17: 79,164,063 (GRCm39) I434N probably damaging Het
Emc1 A G 4: 139,102,512 (GRCm39) T936A probably damaging Het
Fmod A T 1: 133,968,500 (GRCm39) E180V probably damaging Het
Gabrg3 T C 7: 56,634,848 (GRCm39) T112A probably damaging Het
Gak T C 5: 108,754,242 (GRCm39) probably null Het
Gas2 T A 7: 51,603,089 (GRCm39) probably null Het
Gm2381 T A 7: 42,469,655 (GRCm39) Q156H probably benign Het
Golga2 T A 2: 32,189,287 (GRCm39) S273T probably damaging Het
Homez T A 14: 55,094,452 (GRCm39) T419S probably damaging Het
Igfbp6 T A 15: 102,056,617 (GRCm39) Y184* probably null Het
Il11 A G 7: 4,776,733 (GRCm39) S86P probably damaging Het
Itgal A G 7: 126,904,197 (GRCm39) N270S probably benign Het
Lama2 T C 10: 27,066,525 (GRCm39) R1119G probably benign Het
Lamp3 G T 16: 19,494,822 (GRCm39) N294K probably benign Het
Mars1 T C 10: 127,145,948 (GRCm39) I113M possibly damaging Het
Mgat5b A G 11: 116,839,485 (GRCm39) T334A possibly damaging Het
Mis18bp1 A G 12: 65,208,518 (GRCm39) I65T probably benign Het
Mmrn2 A T 14: 34,119,871 (GRCm39) N247I probably benign Het
Muc6 G T 7: 141,236,752 (GRCm39) N322K probably damaging Het
Mx2 A G 16: 97,359,883 (GRCm39) H551R probably benign Het
Nes A G 3: 87,883,286 (GRCm39) E515G probably benign Het
Nfatc3 T G 8: 106,818,792 (GRCm39) S503R probably damaging Het
Nkain3 C A 4: 20,158,339 (GRCm39) probably null Het
Noxa1 A G 2: 24,982,596 (GRCm39) V73A probably damaging Het
Nup160 A T 2: 90,514,302 (GRCm39) E83D probably damaging Het
Or12j3 A T 7: 139,952,655 (GRCm39) Y289* probably null Het
Or4z4 C A 19: 12,076,530 (GRCm39) V158L probably benign Het
Or5ac23 C A 16: 59,149,504 (GRCm39) V123L probably benign Het
Or8b56 A G 9: 38,739,839 (GRCm39) Y284C probably damaging Het
Plxnb2 A G 15: 89,046,187 (GRCm39) probably null Het
Rundc3b A G 5: 8,562,318 (GRCm39) V350A probably benign Het
Scn1a C T 2: 66,148,567 (GRCm39) D993N probably damaging Het
Sec24c G T 14: 20,736,641 (GRCm39) G226V probably null Het
Septin11 T A 5: 93,304,783 (GRCm39) I200N probably damaging Het
Shank3 G T 15: 89,384,099 (GRCm39) G14C probably damaging Het
Skic3 A G 13: 76,270,862 (GRCm39) K153R possibly damaging Het
Slc25a39 T C 11: 102,297,452 (GRCm39) D5G possibly damaging Het
Stoml3 A T 3: 53,412,852 (GRCm39) T169S probably benign Het
Taf1b T A 12: 24,559,125 (GRCm39) I83K possibly damaging Het
Tarbp1 T A 8: 127,154,957 (GRCm39) Q1389L probably damaging Het
Thbs1 T A 2: 117,943,923 (GRCm39) D180E probably benign Het
Tmc5 T A 7: 118,271,462 (GRCm39) V925D probably benign Het
Tmem62 T C 2: 120,809,708 (GRCm39) V130A probably damaging Het
Tpp2 C T 1: 44,029,708 (GRCm39) P997L probably damaging Het
Trip12 A T 1: 84,722,784 (GRCm39) I127N probably damaging Het
Upp2 T C 2: 58,661,562 (GRCm39) F142L possibly damaging Het
Usf3 C T 16: 44,039,995 (GRCm39) Q1492* probably null Het
Vcp T C 4: 42,990,840 (GRCm39) D205G probably damaging Het
Vmn1r180 G A 7: 23,652,394 (GRCm39) V186I possibly damaging Het
Washc2 T C 6: 116,206,267 (GRCm39) S496P probably damaging Het
Wee2 T C 6: 40,441,135 (GRCm39) I480T probably benign Het
Xylt2 T A 11: 94,559,571 (GRCm39) H357L probably damaging Het
Zbed4 T C 15: 88,665,056 (GRCm39) S375P probably damaging Het
Zfp442 A T 2: 150,251,100 (GRCm39) Y266* probably null Het
Zfp600 A G 4: 146,133,497 (GRCm39) T722A probably benign Het
Zfp976 T A 7: 42,265,424 (GRCm39) H55L possibly damaging Het
Other mutations in Mylk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01384:Mylk APN 16 34,759,322 (GRCm39) missense probably benign 0.36
IGL01386:Mylk APN 16 34,791,610 (GRCm39) critical splice acceptor site probably null
IGL01684:Mylk APN 16 34,792,310 (GRCm39) missense possibly damaging 0.55
IGL01884:Mylk APN 16 34,809,247 (GRCm39) splice site probably benign
IGL02079:Mylk APN 16 34,681,001 (GRCm39) missense possibly damaging 0.87
IGL02104:Mylk APN 16 34,635,805 (GRCm39) missense probably benign 0.06
IGL02624:Mylk APN 16 34,750,266 (GRCm39) missense probably benign 0.29
IGL02756:Mylk APN 16 34,784,016 (GRCm39) missense probably benign 0.42
IGL02794:Mylk APN 16 34,806,911 (GRCm39) missense probably benign 0.21
IGL02833:Mylk APN 16 34,735,270 (GRCm39) missense probably benign 0.01
IGL02946:Mylk APN 16 34,742,158 (GRCm39) missense probably benign 0.10
IGL03012:Mylk APN 16 34,773,151 (GRCm39) missense probably benign 0.03
IGL03093:Mylk APN 16 34,732,562 (GRCm39) missense possibly damaging 0.62
IGL03272:Mylk APN 16 34,799,559 (GRCm39) missense probably benign 0.09
billy UTSW 16 34,695,990 (GRCm39) missense probably damaging 0.97
brutus UTSW 16 34,774,065 (GRCm39) missense probably benign 0.12
Club UTSW 16 34,732,645 (GRCm39) nonsense probably null
popeye UTSW 16 34,783,947 (GRCm39) missense probably benign 0.29
F5770:Mylk UTSW 16 34,815,574 (GRCm39) critical splice donor site probably null
P4717OSA:Mylk UTSW 16 34,797,483 (GRCm39) splice site probably benign
PIT4382001:Mylk UTSW 16 34,696,012 (GRCm39) missense probably damaging 0.99
R0131:Mylk UTSW 16 34,695,874 (GRCm39) missense probably benign 0.03
R0309:Mylk UTSW 16 34,732,667 (GRCm39) splice site probably benign
R0358:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0381:Mylk UTSW 16 34,605,344 (GRCm39) splice site probably null
R0390:Mylk UTSW 16 34,695,990 (GRCm39) missense probably damaging 0.97
R0413:Mylk UTSW 16 34,742,314 (GRCm39) missense probably benign 0.01
R0536:Mylk UTSW 16 34,820,757 (GRCm39) missense possibly damaging 0.95
R0544:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0545:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0546:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0547:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0548:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0627:Mylk UTSW 16 34,820,799 (GRCm39) missense probably damaging 1.00
R0726:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0755:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0782:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0783:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0784:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R1136:Mylk UTSW 16 34,820,688 (GRCm39) missense probably damaging 1.00
R1170:Mylk UTSW 16 34,694,409 (GRCm39) missense probably benign 0.20
R1222:Mylk UTSW 16 34,681,022 (GRCm39) missense probably benign 0.12
R1445:Mylk UTSW 16 34,635,835 (GRCm39) missense possibly damaging 0.57
R1583:Mylk UTSW 16 34,695,956 (GRCm39) missense probably benign 0.29
R1618:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R1643:Mylk UTSW 16 34,696,005 (GRCm39) missense probably benign 0.03
R1776:Mylk UTSW 16 34,773,152 (GRCm39) missense probably benign 0.16
R1865:Mylk UTSW 16 34,732,600 (GRCm39) missense probably benign 0.03
R1975:Mylk UTSW 16 34,700,673 (GRCm39) splice site probably null
R2016:Mylk UTSW 16 34,817,187 (GRCm39) missense probably damaging 1.00
R2045:Mylk UTSW 16 34,774,023 (GRCm39) missense probably benign 0.29
R2134:Mylk UTSW 16 34,806,846 (GRCm39) missense probably benign 0.13
R3547:Mylk UTSW 16 34,700,538 (GRCm39) missense possibly damaging 0.61
R3844:Mylk UTSW 16 34,742,247 (GRCm39) missense probably benign 0.01
R4003:Mylk UTSW 16 34,783,947 (GRCm39) missense probably benign 0.29
R4396:Mylk UTSW 16 34,732,645 (GRCm39) nonsense probably null
R4470:Mylk UTSW 16 34,732,522 (GRCm39) missense probably benign 0.09
R4507:Mylk UTSW 16 34,774,065 (GRCm39) missense probably benign 0.12
R4700:Mylk UTSW 16 34,742,805 (GRCm39) missense probably benign 0.16
R4751:Mylk UTSW 16 34,699,539 (GRCm39) missense probably benign 0.29
R4815:Mylk UTSW 16 34,715,295 (GRCm39) missense probably damaging 0.97
R4832:Mylk UTSW 16 34,742,737 (GRCm39) missense probably benign 0.36
R4872:Mylk UTSW 16 34,735,360 (GRCm39) missense possibly damaging 0.89
R4953:Mylk UTSW 16 34,809,331 (GRCm39) missense probably damaging 1.00
R4969:Mylk UTSW 16 34,791,810 (GRCm39) missense probably damaging 0.96
R5009:Mylk UTSW 16 34,719,877 (GRCm39) missense probably benign 0.39
R5130:Mylk UTSW 16 34,809,367 (GRCm39) missense probably damaging 1.00
R5173:Mylk UTSW 16 34,797,383 (GRCm39) missense probably benign 0.40
R5195:Mylk UTSW 16 34,799,585 (GRCm39) missense probably damaging 1.00
R5209:Mylk UTSW 16 34,742,995 (GRCm39) missense possibly damaging 0.55
R5311:Mylk UTSW 16 34,742,127 (GRCm39) missense probably benign 0.01
R5418:Mylk UTSW 16 34,732,600 (GRCm39) missense probably benign 0.02
R5481:Mylk UTSW 16 34,741,974 (GRCm39) missense probably benign 0.09
R5590:Mylk UTSW 16 34,699,722 (GRCm39) missense probably benign 0.29
R5603:Mylk UTSW 16 34,776,862 (GRCm39) missense probably benign 0.06
R5823:Mylk UTSW 16 34,715,317 (GRCm39) critical splice donor site probably null
R6290:Mylk UTSW 16 34,715,213 (GRCm39) missense probably benign 0.39
R6351:Mylk UTSW 16 34,742,341 (GRCm39) missense probably benign 0.01
R6365:Mylk UTSW 16 34,680,961 (GRCm39) missense probably benign 0.12
R6490:Mylk UTSW 16 34,750,237 (GRCm39) missense possibly damaging 0.74
R6723:Mylk UTSW 16 34,750,258 (GRCm39) missense possibly damaging 0.74
R6864:Mylk UTSW 16 34,694,520 (GRCm39) missense probably benign 0.03
R6908:Mylk UTSW 16 34,700,643 (GRCm39) missense probably benign 0.18
R6949:Mylk UTSW 16 34,820,688 (GRCm39) missense probably damaging 1.00
R7018:Mylk UTSW 16 34,820,796 (GRCm39) missense possibly damaging 0.88
R7035:Mylk UTSW 16 34,797,352 (GRCm39) missense possibly damaging 0.89
R7162:Mylk UTSW 16 34,742,899 (GRCm39) missense probably damaging 1.00
R7236:Mylk UTSW 16 34,742,899 (GRCm39) missense probably damaging 1.00
R7269:Mylk UTSW 16 34,605,381 (GRCm39) missense probably damaging 0.96
R7475:Mylk UTSW 16 34,734,446 (GRCm39) splice site probably null
R7525:Mylk UTSW 16 34,809,357 (GRCm39) missense probably benign 0.06
R7587:Mylk UTSW 16 34,742,887 (GRCm39) missense probably benign 0.29
R7607:Mylk UTSW 16 34,715,184 (GRCm39) missense probably benign 0.09
R7616:Mylk UTSW 16 34,699,927 (GRCm39) missense probably damaging 0.97
R7647:Mylk UTSW 16 34,699,894 (GRCm39) missense probably benign 0.29
R7648:Mylk UTSW 16 34,699,894 (GRCm39) missense probably benign 0.29
R7764:Mylk UTSW 16 34,742,553 (GRCm39) missense probably benign 0.16
R7890:Mylk UTSW 16 34,784,018 (GRCm39) nonsense probably null
R7892:Mylk UTSW 16 34,699,894 (GRCm39) missense probably benign 0.29
R7893:Mylk UTSW 16 34,699,894 (GRCm39) missense probably benign 0.29
R8065:Mylk UTSW 16 34,792,389 (GRCm39) missense probably benign 0.08
R8067:Mylk UTSW 16 34,792,389 (GRCm39) missense probably benign 0.08
R8143:Mylk UTSW 16 34,734,525 (GRCm39) missense possibly damaging 0.87
R8210:Mylk UTSW 16 34,820,721 (GRCm39) missense probably damaging 1.00
R8271:Mylk UTSW 16 34,742,949 (GRCm39) missense probably damaging 0.97
R8540:Mylk UTSW 16 34,750,257 (GRCm39) missense possibly damaging 0.87
R8721:Mylk UTSW 16 34,817,176 (GRCm39) missense probably damaging 1.00
R8743:Mylk UTSW 16 34,741,427 (GRCm39) missense probably benign 0.03
R8798:Mylk UTSW 16 34,719,772 (GRCm39) missense possibly damaging 0.89
R8956:Mylk UTSW 16 34,791,779 (GRCm39) missense probably benign 0.01
R9131:Mylk UTSW 16 34,776,835 (GRCm39) missense probably benign 0.29
R9403:Mylk UTSW 16 34,696,012 (GRCm39) nonsense probably null
R9624:Mylk UTSW 16 34,699,677 (GRCm39) missense probably benign 0.29
R9735:Mylk UTSW 16 34,735,179 (GRCm39) missense probably benign 0.09
R9756:Mylk UTSW 16 34,734,387 (GRCm39) missense probably damaging 0.96
R9763:Mylk UTSW 16 34,699,482 (GRCm39) nonsense probably null
RF001:Mylk UTSW 16 34,699,741 (GRCm39) missense probably benign 0.03
V7580:Mylk UTSW 16 34,815,574 (GRCm39) critical splice donor site probably null
V7583:Mylk UTSW 16 34,815,574 (GRCm39) critical splice donor site probably null
X0065:Mylk UTSW 16 34,820,811 (GRCm39) missense probably damaging 1.00
Z1177:Mylk UTSW 16 34,743,021 (GRCm39) missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- TGACGTTTCAGCCTTACCCAGC -3'
(R):5'- AGCCTTGACATTCAAGACCTCAGC -3'

Sequencing Primer
(F):5'- ATGGTGACCGTCATGGGAC -3'
(R):5'- CGCTGTTGCCCCCATTC -3'
Posted On 2014-05-14