Incidental Mutation 'R1702:Or5ac23'
ID 189843
Institutional Source Beutler Lab
Gene Symbol Or5ac23
Ensembl Gene ENSMUSG00000094422
Gene Name olfactory receptor family 5 subfamily AC member 23
Synonyms Olfr205, MOR182-11P, GA_x54KRFPKG5P-55543875-55542958
MMRRC Submission 039735-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.090) question?
Stock # R1702 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 59148953-59149870 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 59149504 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Leucine at position 123 (V123L)
Ref Sequence ENSEMBL: ENSMUSP00000149415 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074125] [ENSMUST00000213910]
AlphaFold Q7TS37
Predicted Effect probably benign
Transcript: ENSMUST00000074125
AA Change: V123L

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000073762
Gene: ENSMUSG00000094422
AA Change: V123L

DomainStartEndE-ValueType
Pfam:7tm_4 30 305 1.6e-49 PFAM
Pfam:7TM_GPCR_Srsx 34 302 1.6e-7 PFAM
Pfam:7tm_1 40 289 7.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213910
AA Change: V123L

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T C 7: 119,981,925 (GRCm39) V1080A probably benign Het
Abcg4 A C 9: 44,186,370 (GRCm39) V553G probably damaging Het
Ache T C 5: 137,289,251 (GRCm39) V319A possibly damaging Het
Acsm2 T A 7: 119,172,787 (GRCm39) M134K possibly damaging Het
Ank2 A T 3: 126,749,548 (GRCm39) S494T probably benign Het
Asic3 A T 5: 24,620,454 (GRCm39) T202S probably damaging Het
Baiap3 T A 17: 25,463,779 (GRCm39) H886L probably damaging Het
Bltp2 T A 11: 78,179,854 (GRCm39) C2126S probably damaging Het
Cidea T A 18: 67,499,491 (GRCm39) I126K probably damaging Het
Cmklr1 T G 5: 113,751,903 (GRCm39) K366T probably benign Het
Cntrl A T 2: 35,061,848 (GRCm39) probably null Het
Crhr2 A G 6: 55,069,520 (GRCm39) F378S probably damaging Het
Deaf1 C G 7: 140,894,867 (GRCm39) R303T probably damaging Het
Dnah9 T A 11: 65,976,021 (GRCm39) N1343Y possibly damaging Het
Dop1b A G 16: 93,544,509 (GRCm39) K99E possibly damaging Het
Dpp4 A T 2: 62,216,773 (GRCm39) probably null Het
Dst T C 1: 34,206,421 (GRCm39) V598A probably damaging Het
Ece2 C T 16: 20,449,996 (GRCm39) R136C probably damaging Het
Efcab3 C T 11: 104,581,832 (GRCm39) P58L probably benign Het
Egf C A 3: 129,484,460 (GRCm39) V453L probably benign Het
Egr3 T A 14: 70,317,216 (GRCm39) F342L probably damaging Het
Eif2ak2 A T 17: 79,164,063 (GRCm39) I434N probably damaging Het
Emc1 A G 4: 139,102,512 (GRCm39) T936A probably damaging Het
Fmod A T 1: 133,968,500 (GRCm39) E180V probably damaging Het
Gabrg3 T C 7: 56,634,848 (GRCm39) T112A probably damaging Het
Gak T C 5: 108,754,242 (GRCm39) probably null Het
Gas2 T A 7: 51,603,089 (GRCm39) probably null Het
Gm2381 T A 7: 42,469,655 (GRCm39) Q156H probably benign Het
Golga2 T A 2: 32,189,287 (GRCm39) S273T probably damaging Het
Homez T A 14: 55,094,452 (GRCm39) T419S probably damaging Het
Igfbp6 T A 15: 102,056,617 (GRCm39) Y184* probably null Het
Il11 A G 7: 4,776,733 (GRCm39) S86P probably damaging Het
Itgal A G 7: 126,904,197 (GRCm39) N270S probably benign Het
Lama2 T C 10: 27,066,525 (GRCm39) R1119G probably benign Het
Lamp3 G T 16: 19,494,822 (GRCm39) N294K probably benign Het
Mars1 T C 10: 127,145,948 (GRCm39) I113M possibly damaging Het
Mgat5b A G 11: 116,839,485 (GRCm39) T334A possibly damaging Het
Mis18bp1 A G 12: 65,208,518 (GRCm39) I65T probably benign Het
Mmrn2 A T 14: 34,119,871 (GRCm39) N247I probably benign Het
Muc6 G T 7: 141,236,752 (GRCm39) N322K probably damaging Het
Mx2 A G 16: 97,359,883 (GRCm39) H551R probably benign Het
Mylk T A 16: 34,742,314 (GRCm39) V942E probably benign Het
Nes A G 3: 87,883,286 (GRCm39) E515G probably benign Het
Nfatc3 T G 8: 106,818,792 (GRCm39) S503R probably damaging Het
Nkain3 C A 4: 20,158,339 (GRCm39) probably null Het
Noxa1 A G 2: 24,982,596 (GRCm39) V73A probably damaging Het
Nup160 A T 2: 90,514,302 (GRCm39) E83D probably damaging Het
Or12j3 A T 7: 139,952,655 (GRCm39) Y289* probably null Het
Or4z4 C A 19: 12,076,530 (GRCm39) V158L probably benign Het
Or8b56 A G 9: 38,739,839 (GRCm39) Y284C probably damaging Het
Plxnb2 A G 15: 89,046,187 (GRCm39) probably null Het
Rundc3b A G 5: 8,562,318 (GRCm39) V350A probably benign Het
Scn1a C T 2: 66,148,567 (GRCm39) D993N probably damaging Het
Sec24c G T 14: 20,736,641 (GRCm39) G226V probably null Het
Septin11 T A 5: 93,304,783 (GRCm39) I200N probably damaging Het
Shank3 G T 15: 89,384,099 (GRCm39) G14C probably damaging Het
Skic3 A G 13: 76,270,862 (GRCm39) K153R possibly damaging Het
Slc25a39 T C 11: 102,297,452 (GRCm39) D5G possibly damaging Het
Stoml3 A T 3: 53,412,852 (GRCm39) T169S probably benign Het
Taf1b T A 12: 24,559,125 (GRCm39) I83K possibly damaging Het
Tarbp1 T A 8: 127,154,957 (GRCm39) Q1389L probably damaging Het
Thbs1 T A 2: 117,943,923 (GRCm39) D180E probably benign Het
Tmc5 T A 7: 118,271,462 (GRCm39) V925D probably benign Het
Tmem62 T C 2: 120,809,708 (GRCm39) V130A probably damaging Het
Tpp2 C T 1: 44,029,708 (GRCm39) P997L probably damaging Het
Trip12 A T 1: 84,722,784 (GRCm39) I127N probably damaging Het
Upp2 T C 2: 58,661,562 (GRCm39) F142L possibly damaging Het
Usf3 C T 16: 44,039,995 (GRCm39) Q1492* probably null Het
Vcp T C 4: 42,990,840 (GRCm39) D205G probably damaging Het
Vmn1r180 G A 7: 23,652,394 (GRCm39) V186I possibly damaging Het
Washc2 T C 6: 116,206,267 (GRCm39) S496P probably damaging Het
Wee2 T C 6: 40,441,135 (GRCm39) I480T probably benign Het
Xylt2 T A 11: 94,559,571 (GRCm39) H357L probably damaging Het
Zbed4 T C 15: 88,665,056 (GRCm39) S375P probably damaging Het
Zfp442 A T 2: 150,251,100 (GRCm39) Y266* probably null Het
Zfp600 A G 4: 146,133,497 (GRCm39) T722A probably benign Het
Zfp976 T A 7: 42,265,424 (GRCm39) H55L possibly damaging Het
Other mutations in Or5ac23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02475:Or5ac23 APN 16 59,149,088 (GRCm39) missense probably benign 0.21
IGL03236:Or5ac23 APN 16 59,149,200 (GRCm39) missense probably damaging 0.97
R0054:Or5ac23 UTSW 16 59,149,428 (GRCm39) missense possibly damaging 0.57
R0054:Or5ac23 UTSW 16 59,149,428 (GRCm39) missense possibly damaging 0.57
R0167:Or5ac23 UTSW 16 59,149,337 (GRCm39) nonsense probably null
R0178:Or5ac23 UTSW 16 59,149,783 (GRCm39) missense probably damaging 1.00
R0371:Or5ac23 UTSW 16 59,149,585 (GRCm39) missense possibly damaging 0.60
R0577:Or5ac23 UTSW 16 59,149,061 (GRCm39) missense probably benign 0.01
R0597:Or5ac23 UTSW 16 59,149,123 (GRCm39) missense probably damaging 1.00
R0967:Or5ac23 UTSW 16 59,149,546 (GRCm39) missense possibly damaging 0.66
R1670:Or5ac23 UTSW 16 59,149,607 (GRCm39) missense probably benign 0.03
R1995:Or5ac23 UTSW 16 59,149,654 (GRCm39) missense probably damaging 1.00
R2239:Or5ac23 UTSW 16 59,149,738 (GRCm39) missense probably damaging 0.99
R4063:Or5ac23 UTSW 16 59,149,243 (GRCm39) missense probably benign 0.05
R4400:Or5ac23 UTSW 16 59,148,961 (GRCm39) missense probably benign
R4666:Or5ac23 UTSW 16 59,149,573 (GRCm39) missense possibly damaging 0.91
R4795:Or5ac23 UTSW 16 59,149,213 (GRCm39) missense probably benign 0.09
R5327:Or5ac23 UTSW 16 59,149,461 (GRCm39) missense probably benign 0.01
R5471:Or5ac23 UTSW 16 59,148,994 (GRCm39) missense probably damaging 1.00
R5770:Or5ac23 UTSW 16 59,149,514 (GRCm39) nonsense probably null
R6195:Or5ac23 UTSW 16 59,149,785 (GRCm39) missense possibly damaging 0.81
R6702:Or5ac23 UTSW 16 59,148,961 (GRCm39) missense probably benign
R7686:Or5ac23 UTSW 16 59,149,379 (GRCm39) missense probably damaging 1.00
R7908:Or5ac23 UTSW 16 59,149,606 (GRCm39) missense possibly damaging 0.48
R7911:Or5ac23 UTSW 16 59,149,606 (GRCm39) missense possibly damaging 0.48
R7912:Or5ac23 UTSW 16 59,149,606 (GRCm39) missense possibly damaging 0.48
R7913:Or5ac23 UTSW 16 59,149,606 (GRCm39) missense possibly damaging 0.48
R7998:Or5ac23 UTSW 16 59,149,633 (GRCm39) missense probably benign 0.09
R8772:Or5ac23 UTSW 16 59,149,051 (GRCm39) missense probably damaging 1.00
R9563:Or5ac23 UTSW 16 59,149,765 (GRCm39) missense probably benign 0.00
X0026:Or5ac23 UTSW 16 59,149,713 (GRCm39) missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TTCAGGACCGCAAATAGGACACG -3'
(R):5'- TGGAAGGACCCTCATCTTCACACAC -3'

Sequencing Primer
(F):5'- AGTCACAGAGGTACTGATTTGTATG -3'
(R):5'- CATGTACCTTTTCCTTGGAAATTTGG -3'
Posted On 2014-05-14