Incidental Mutation 'R1702:Mx2'
ID189845
Institutional Source Beutler Lab
Gene Symbol Mx2
Ensembl Gene ENSMUSG00000023341
Gene NameMX dynamin-like GTPase 2
SynonymsMx-2
MMRRC Submission 039735-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.220) question?
Stock #R1702 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location97535308-97560900 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 97558683 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 551 (H551R)
Ref Sequence ENSEMBL: ENSMUSP00000024112 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024112] [ENSMUST00000188251] [ENSMUST00000190447]
Predicted Effect probably benign
Transcript: ENSMUST00000024112
AA Change: H551R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000024112
Gene: ENSMUSG00000023341
AA Change: H551R

DomainStartEndE-ValueType
DYNc 39 282 2.71e-135 SMART
Blast:DYNc 426 539 4e-17 BLAST
GED 562 653 9.88e-30 SMART
Predicted Effect silent
Transcript: ENSMUST00000188251
SMART Domains Protein: ENSMUSP00000141038
Gene: ENSMUSG00000023341

DomainStartEndE-ValueType
DYNc 39 282 1.3e-137 SMART
low complexity region 592 603 N/A INTRINSIC
low complexity region 619 637 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000190447
SMART Domains Protein: ENSMUSP00000140229
Gene: ENSMUSG00000023341

DomainStartEndE-ValueType
DYNc 39 282 1.3e-137 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191103
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype Mx1+ strains do not express MX2 protein. The Mx2 gene in BALB/cJ and CBA/J is interrupted by an open reading frame mutation. Mutagenesis correcting the frameshift permits Mx2 expression in 3T3 cells. This protein did not inhibit influenza virus but conferred resistance to vesicular stomatitis virus.
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,289,028 C2126S probably damaging Het
Abca15 T C 7: 120,382,702 V1080A probably benign Het
Abcg4 A C 9: 44,275,073 V553G probably damaging Het
Ache T C 5: 137,290,989 V319A possibly damaging Het
Acsm2 T A 7: 119,573,564 M134K possibly damaging Het
Ank2 A T 3: 126,955,899 S494T probably benign Het
Asic3 A T 5: 24,415,456 T202S probably damaging Het
Baiap3 T A 17: 25,244,805 H886L probably damaging Het
Cidea T A 18: 67,366,421 I126K probably damaging Het
Cmklr1 T G 5: 113,613,842 K366T probably benign Het
Cntrl A T 2: 35,171,836 probably null Het
Crhr2 A G 6: 55,092,535 F378S probably damaging Het
Deaf1 C G 7: 141,314,954 R303T probably damaging Het
Dnah9 T A 11: 66,085,195 N1343Y possibly damaging Het
Dopey2 A G 16: 93,747,621 K99E possibly damaging Het
Dpp4 A T 2: 62,386,429 probably null Het
Dst T C 1: 34,167,340 V598A probably damaging Het
Ece2 C T 16: 20,631,246 R136C probably damaging Het
Egf C A 3: 129,690,811 V453L probably benign Het
Egr3 T A 14: 70,079,767 F342L probably damaging Het
Eif2ak2 A T 17: 78,856,634 I434N probably damaging Het
Emc1 A G 4: 139,375,201 T936A probably damaging Het
Fmod A T 1: 134,040,762 E180V probably damaging Het
Gabrg3 T C 7: 56,985,100 T112A probably damaging Het
Gak T C 5: 108,606,376 probably null Het
Gas2 T A 7: 51,953,341 probably null Het
Gm11639 C T 11: 104,691,006 P58L probably benign Het
Gm2381 T A 7: 42,820,231 Q156H probably benign Het
Golga2 T A 2: 32,299,275 S273T probably damaging Het
Homez T A 14: 54,856,995 T419S probably damaging Het
Igfbp6 T A 15: 102,148,182 Y184* probably null Het
Il11 A G 7: 4,773,734 S86P probably damaging Het
Itgal A G 7: 127,305,025 N270S probably benign Het
Lama2 T C 10: 27,190,529 R1119G probably benign Het
Lamp3 G T 16: 19,676,072 N294K probably benign Het
Mars T C 10: 127,310,079 I113M possibly damaging Het
Mgat5b A G 11: 116,948,659 T334A possibly damaging Het
Mis18bp1 A G 12: 65,161,744 I65T probably benign Het
Mmrn2 A T 14: 34,397,914 N247I probably benign Het
Muc6 G T 7: 141,650,487 N322K probably damaging Het
Mylk T A 16: 34,921,944 V942E probably benign Het
Nes A G 3: 87,975,979 E515G probably benign Het
Nfatc3 T G 8: 106,092,160 S503R probably damaging Het
Nkain3 C A 4: 20,158,339 probably null Het
Noxa1 A G 2: 25,092,584 V73A probably damaging Het
Nup160 A T 2: 90,683,958 E83D probably damaging Het
Olfr1427 C A 19: 12,099,166 V158L probably benign Het
Olfr205 C A 16: 59,329,141 V123L probably benign Het
Olfr530 A T 7: 140,372,742 Y289* probably null Het
Olfr923 A G 9: 38,828,543 Y284C probably damaging Het
Plxnb2 A G 15: 89,161,984 probably null Het
Rundc3b A G 5: 8,512,318 V350A probably benign Het
Scn1a C T 2: 66,318,223 D993N probably damaging Het
Sec24c G T 14: 20,686,573 G226V probably null Het
Sept11 T A 5: 93,156,924 I200N probably damaging Het
Shank3 G T 15: 89,499,896 G14C probably damaging Het
Slc25a39 T C 11: 102,406,626 D5G possibly damaging Het
Stoml3 A T 3: 53,505,431 T169S probably benign Het
Taf1b T A 12: 24,509,126 I83K possibly damaging Het
Tarbp1 T A 8: 126,428,218 Q1389L probably damaging Het
Thbs1 T A 2: 118,113,442 D180E probably benign Het
Tmc5 T A 7: 118,672,239 V925D probably benign Het
Tmem62 T C 2: 120,979,227 V130A probably damaging Het
Tpp2 C T 1: 43,990,548 P997L probably damaging Het
Trip12 A T 1: 84,745,063 I127N probably damaging Het
Ttc37 A G 13: 76,122,743 K153R possibly damaging Het
Upp2 T C 2: 58,771,550 F142L possibly damaging Het
Usf3 C T 16: 44,219,632 Q1492* probably null Het
Vcp T C 4: 42,990,840 D205G probably damaging Het
Vmn1r180 G A 7: 23,952,969 V186I possibly damaging Het
Washc2 T C 6: 116,229,306 S496P probably damaging Het
Wee2 T C 6: 40,464,201 I480T probably benign Het
Xylt2 T A 11: 94,668,745 H357L probably damaging Het
Zbed4 T C 15: 88,780,853 S375P probably damaging Het
Zfp442 A T 2: 150,409,180 Y266* probably null Het
Zfp600 A G 4: 146,196,927 T722A probably benign Het
Zfp976 T A 7: 42,616,000 H55L possibly damaging Het
Other mutations in Mx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Mx2 APN 16 97544478 missense probably damaging 0.99
IGL01111:Mx2 APN 16 97558719 missense probably benign
IGL02103:Mx2 APN 16 97544595 missense probably damaging 1.00
IGL02678:Mx2 APN 16 97556120 critical splice donor site probably null
IGL03166:Mx2 APN 16 97546790 missense probably damaging 1.00
IGL03323:Mx2 APN 16 97546375 missense probably damaging 0.99
R0254:Mx2 UTSW 16 97556095 missense probably benign
R0699:Mx2 UTSW 16 97544553 missense probably damaging 1.00
R1180:Mx2 UTSW 16 97556009 missense probably damaging 1.00
R1762:Mx2 UTSW 16 97538703 missense probably benign 0.09
R1922:Mx2 UTSW 16 97560351 missense probably benign 0.05
R2049:Mx2 UTSW 16 97538703 missense probably benign 0.09
R2141:Mx2 UTSW 16 97538703 missense probably benign 0.09
R2142:Mx2 UTSW 16 97538703 missense probably benign 0.09
R3010:Mx2 UTSW 16 97546799 missense possibly damaging 0.85
R4079:Mx2 UTSW 16 97556036 missense probably damaging 0.98
R4553:Mx2 UTSW 16 97552005 missense possibly damaging 0.52
R4594:Mx2 UTSW 16 97547432 nonsense probably null
R5211:Mx2 UTSW 16 97547433 missense probably damaging 1.00
R5785:Mx2 UTSW 16 97538704 missense possibly damaging 0.90
R6091:Mx2 UTSW 16 97546435 missense probably damaging 1.00
R7250:Mx2 UTSW 16 97547464 missense probably damaging 0.99
R7485:Mx2 UTSW 16 97545718 missense probably benign 0.11
R7793:Mx2 UTSW 16 97546883 missense probably damaging 1.00
R7816:Mx2 UTSW 16 97545612 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTTCTACCTTCAGCTCAGGTGACC -3'
(R):5'- TGAAACCCGTTGCAGACTTATACCC -3'

Sequencing Primer
(F):5'- GGACTGCTTCCAGGTAATGAC -3'
(R):5'- GTTGCAGACTTATACCCTACACAGAG -3'
Posted On2014-05-14