Incidental Mutation 'R1703:Rp1'
ID189850
Institutional Source Beutler Lab
Gene Symbol Rp1
Ensembl Gene ENSMUSG00000025900
Gene Nameretinitis pigmentosa 1 (human)
SynonymsDcdc3, mG145, Orp1, oxygen-regulated protein 1, Rp1h
MMRRC Submission 039736-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R1703 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location3999557-4409241 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 4345169 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 1907 (I1907F)
Ref Sequence ENSEMBL: ENSMUSP00000027032 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027032] [ENSMUST00000194992] [ENSMUST00000208660]
Predicted Effect probably damaging
Transcript: ENSMUST00000027032
AA Change: I1907F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000027032
Gene: ENSMUSG00000025900
AA Change: I1907F

DomainStartEndE-ValueType
DCX 30 117 4.37e-39 SMART
low complexity region 120 133 N/A INTRINSIC
DCX 152 236 7.17e-35 SMART
low complexity region 343 354 N/A INTRINSIC
low complexity region 403 414 N/A INTRINSIC
low complexity region 462 473 N/A INTRINSIC
low complexity region 646 661 N/A INTRINSIC
low complexity region 1113 1123 N/A INTRINSIC
low complexity region 1396 1412 N/A INTRINSIC
low complexity region 1434 1444 N/A INTRINSIC
low complexity region 1648 1661 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194992
SMART Domains Protein: ENSMUSP00000142146
Gene: ENSMUSG00000025900

DomainStartEndE-ValueType
DCX 40 127 4.37e-39 SMART
low complexity region 130 143 N/A INTRINSIC
DCX 162 246 7.17e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000208660
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208793
Meta Mutation Damage Score 0.1086 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.4%
Validation Efficiency 99% (86/87)
MGI Phenotype FUNCTION: This gene encodes a member of the doublecortin family. The protein encoded by this gene contains two doublecortin domains, which bind microtubules and regulate microtubule polymerization. The encoded protein is a photoreceptor microtubule-associated protein and is required for correct stacking of outer segment disc. This protein and the RP1L1 protein, another retinal-specific protein, play essential and synergistic roles in affecting photosensitivity and outer segment morphogenesis of rod photoreceptors. Because of its response to in vivo retinal oxygen levels, this protein was initially named ORP1 (oxygen-regulated protein-1). This protein was subsequently designated RP1 (retinitis pigmentosa 1) when it was found that mutations in this gene cause autosomal dominant retinitis pigmentosa. Mutations in this gene also cause autosomal recessive retinitis pigmentosa. Two transcript variants encoding distinct isoforms are resulted from alternative promoters and alternative splicing. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene experience progressive degeneration in photoreceptors but are otherwise phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057M21Rik A T 7: 131,343,702 Y401* probably null Het
4932415M13Rik C A 17: 53,725,037 noncoding transcript Het
Acoxl T A 2: 127,978,772 S81R probably damaging Het
Adamtsl4 A G 3: 95,677,614 C915R probably damaging Het
Adgra3 C T 5: 50,006,775 M287I probably benign Het
Afg1l T G 10: 42,400,399 D250A probably damaging Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Amfr T C 8: 93,974,243 T530A probably benign Het
Ank2 C T 3: 126,929,766 V971M probably damaging Het
App A G 16: 84,965,768 S656P probably damaging Het
Arid5a T A 1: 36,319,575 probably null Het
Asic5 T A 3: 81,999,722 V60D possibly damaging Het
Atm G T 9: 53,500,700 H1019N probably benign Het
Btbd11 A G 10: 85,387,384 D19G unknown Het
Cep250 A G 2: 155,965,546 K277R probably benign Het
Chrna7 C T 7: 63,099,507 R409H probably damaging Het
Chrng A T 1: 87,210,906 N419I possibly damaging Het
Ciao1 T C 2: 127,245,819 S199G probably benign Het
Clstn2 A T 9: 97,458,237 M694K possibly damaging Het
Cpeb2 A G 5: 43,233,838 probably benign Het
Cyp2c69 T A 19: 39,876,366 I223F probably benign Het
Dennd1b A T 1: 139,169,754 probably null Het
Dnah17 A T 11: 118,026,749 L4162Q probably damaging Het
Dnm1 T C 2: 32,323,451 M506V probably benign Het
Ecsit A G 9: 22,074,811 V173A probably damaging Het
Fam13b T C 18: 34,451,439 probably null Het
Fgl2 T A 5: 21,372,732 W6R possibly damaging Het
Galnt9 G A 5: 110,619,172 R503H probably damaging Het
Gm884 C T 11: 103,540,874 V1372I probably benign Het
Gramd1a C T 7: 31,139,534 V247M possibly damaging Het
Grip2 A T 6: 91,777,398 I632N probably damaging Het
Hspg2 T C 4: 137,559,151 V3627A probably damaging Het
Ipo8 T C 6: 148,789,892 Y660C probably benign Het
Isg15 T C 4: 156,199,808 R88G possibly damaging Het
Itgb5 T A 16: 33,910,500 D388E probably benign Het
Jhy T C 9: 40,944,837 Y118C probably damaging Het
Kalrn G A 16: 34,205,326 T931M probably damaging Het
Kif21a A G 15: 90,949,047 probably null Het
Lama2 A T 10: 27,266,671 Y604N probably damaging Het
Lrp3 T G 7: 35,213,161 S34R possibly damaging Het
Lyn T C 4: 3,738,867 probably null Het
Mroh8 C T 2: 157,271,976 V132I probably benign Het
Mthfd1l T C 10: 4,148,093 F977L probably damaging Het
Nol8 C T 13: 49,667,457 T912M possibly damaging Het
Nrxn1 A T 17: 90,208,417 N169K probably damaging Het
Olfr1118 T C 2: 87,309,410 V207A probably benign Het
Olfr1188 T A 2: 88,560,255 M262K possibly damaging Het
Oplah A G 15: 76,296,667 Y1279H probably benign Het
Pcsk5 T C 19: 17,752,094 N129S probably benign Het
Pcyt2 G T 11: 120,613,068 P185T probably benign Het
Pdlim2 A G 14: 70,174,335 probably null Het
Pgs1 T C 11: 118,014,728 probably benign Het
Qprt A G 7: 127,108,171 V251A probably benign Het
Rasal2 A C 1: 157,157,600 L834R probably damaging Het
Reg1 T C 6: 78,428,449 C161R probably damaging Het
S1pr5 T C 9: 21,244,050 D360G possibly damaging Het
Sart3 C A 5: 113,752,219 V482F probably benign Het
Scarf2 A G 16: 17,802,849 E127G probably damaging Het
Serinc5 T C 13: 92,688,797 S245P probably damaging Het
Serpinc1 G T 1: 160,993,517 R57L probably damaging Het
Setd2 A G 9: 110,549,864 S632G probably benign Het
Sgca A T 11: 94,969,391 L307M probably damaging Het
Slc7a9 C A 7: 35,454,575 Q208K probably benign Het
Slfn10-ps C T 11: 83,030,043 noncoding transcript Het
Spam1 A T 6: 24,796,257 D69V probably damaging Het
Tanc1 A G 2: 59,843,021 E1490G probably benign Het
Tbc1d22a G T 15: 86,239,215 D150Y probably benign Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Tlx1 A G 19: 45,156,004 D55G possibly damaging Het
Tram2 G T 1: 21,004,234 N241K probably damaging Het
Ttc23l T C 15: 10,523,658 Y325C probably damaging Het
Ubac2 T A 14: 121,905,170 S27T probably benign Het
Utrn G A 10: 12,727,729 probably benign Het
Vnn3 A T 10: 23,865,930 M378L probably benign Het
Vps18 T A 2: 119,289,057 D6E probably benign Het
Xkr5 T A 8: 18,939,118 I253F probably benign Het
Yeats4 A T 10: 117,215,723 C210S probably benign Het
Zdhhc20 A G 14: 57,839,088 probably null Het
Other mutations in Rp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Rp1 APN 1 4346746 missense probably damaging 0.98
IGL00593:Rp1 APN 1 4345403 missense possibly damaging 0.70
IGL00956:Rp1 APN 1 4352212 missense probably damaging 1.00
IGL01070:Rp1 APN 1 4345238 missense probably damaging 1.00
IGL01531:Rp1 APN 1 4348945 missense probably benign 0.00
IGL01668:Rp1 APN 1 4345718 missense probably damaging 1.00
IGL01907:Rp1 APN 1 4348507 missense possibly damaging 0.56
IGL02055:Rp1 APN 1 4352522 missense probably damaging 1.00
IGL02071:Rp1 APN 1 4345310 missense possibly damaging 0.46
IGL02128:Rp1 APN 1 4347385 missense probably damaging 0.99
IGL02244:Rp1 APN 1 4348780 missense probably benign 0.00
IGL02381:Rp1 APN 1 4352390 missense probably benign 0.01
IGL02499:Rp1 APN 1 4349048 missense probably benign 0.17
IGL02619:Rp1 APN 1 4348450 missense possibly damaging 0.73
IGL02832:Rp1 APN 1 4349713 missense probably benign 0.03
IGL02861:Rp1 APN 1 4346152 nonsense probably null
IGL03288:Rp1 APN 1 4349524 missense possibly damaging 0.88
IGL03290:Rp1 APN 1 4350041 missense probably damaging 1.00
IGL03303:Rp1 APN 1 4344817 missense probably damaging 1.00
R0041:Rp1 UTSW 1 4344628 missense probably benign 0.36
R0111:Rp1 UTSW 1 4344760 missense probably damaging 1.00
R0363:Rp1 UTSW 1 4347718 missense probably damaging 1.00
R0440:Rp1 UTSW 1 4345640 missense probably damaging 1.00
R0442:Rp1 UTSW 1 4346747 missense probably benign 0.09
R0528:Rp1 UTSW 1 4344865 missense possibly damaging 0.82
R0586:Rp1 UTSW 1 4347837 missense possibly damaging 0.76
R0639:Rp1 UTSW 1 4346498 missense probably benign 0.00
R0856:Rp1 UTSW 1 4344655 missense probably benign 0.05
R0908:Rp1 UTSW 1 4344655 missense probably benign 0.05
R0968:Rp1 UTSW 1 4345352 missense probably benign 0.00
R1099:Rp1 UTSW 1 4352290 missense possibly damaging 0.45
R1242:Rp1 UTSW 1 4344962 missense probably benign 0.03
R1301:Rp1 UTSW 1 4345936 missense possibly damaging 0.56
R1327:Rp1 UTSW 1 4347970 missense probably benign 0.01
R1403:Rp1 UTSW 1 4346297 missense possibly damaging 0.73
R1403:Rp1 UTSW 1 4346297 missense possibly damaging 0.73
R1406:Rp1 UTSW 1 4351921 missense possibly damaging 0.88
R1406:Rp1 UTSW 1 4351921 missense possibly damaging 0.88
R1440:Rp1 UTSW 1 4347396 missense probably damaging 1.00
R1509:Rp1 UTSW 1 4347694 missense probably damaging 0.98
R1509:Rp1 UTSW 1 4348537 missense probably benign 0.20
R1538:Rp1 UTSW 1 4345676 missense probably damaging 1.00
R1609:Rp1 UTSW 1 4349201 missense probably damaging 1.00
R1666:Rp1 UTSW 1 4349863 missense probably damaging 1.00
R1782:Rp1 UTSW 1 4349089 missense probably benign 0.00
R1799:Rp1 UTSW 1 4348832 missense possibly damaging 0.94
R1848:Rp1 UTSW 1 4347232 missense possibly damaging 0.76
R1908:Rp1 UTSW 1 4348720 missense probably damaging 0.99
R1919:Rp1 UTSW 1 4352671 missense probably damaging 0.99
R2087:Rp1 UTSW 1 4348352 missense probably damaging 1.00
R2211:Rp1 UTSW 1 4348139 missense probably damaging 0.96
R2278:Rp1 UTSW 1 4348027 missense possibly damaging 0.51
R2287:Rp1 UTSW 1 4345959 nonsense probably null
R2316:Rp1 UTSW 1 4345640 missense probably damaging 1.00
R2346:Rp1 UTSW 1 4348013 missense probably damaging 1.00
R2878:Rp1 UTSW 1 4348139 missense probably damaging 1.00
R3023:Rp1 UTSW 1 4352675 missense probably damaging 1.00
R3025:Rp1 UTSW 1 4352675 missense probably damaging 1.00
R3716:Rp1 UTSW 1 4349765 missense probably benign 0.38
R3814:Rp1 UTSW 1 4349708 missense probably benign
R3929:Rp1 UTSW 1 4352645 missense probably damaging 1.00
R4064:Rp1 UTSW 1 4345400 missense probably benign 0.08
R4426:Rp1 UTSW 1 4347924 missense probably benign 0.13
R4557:Rp1 UTSW 1 4344663 missense possibly damaging 0.61
R4764:Rp1 UTSW 1 4345878 missense probably damaging 0.96
R4845:Rp1 UTSW 1 4349228 missense probably benign 0.02
R4850:Rp1 UTSW 1 4348675 missense probably damaging 1.00
R4857:Rp1 UTSW 1 4352316 missense probably damaging 0.99
R4857:Rp1 UTSW 1 4352317 missense probably damaging 1.00
R5159:Rp1 UTSW 1 4346203 missense possibly damaging 0.73
R5226:Rp1 UTSW 1 4348033 missense probably benign 0.01
R5327:Rp1 UTSW 1 4349360 splice site probably null
R5352:Rp1 UTSW 1 4347098 missense probably benign 0.00
R5504:Rp1 UTSW 1 4349890 missense probably damaging 1.00
R5527:Rp1 UTSW 1 4346393 missense possibly damaging 0.75
R5529:Rp1 UTSW 1 4345832 missense probably benign 0.42
R5569:Rp1 UTSW 1 4345237 missense probably damaging 1.00
R5622:Rp1 UTSW 1 4347837 missense possibly damaging 0.76
R5970:Rp1 UTSW 1 4348462 missense probably benign 0.05
R5992:Rp1 UTSW 1 4148703 missense unknown
R6004:Rp1 UTSW 1 4197585 missense unknown
R6018:Rp1 UTSW 1 4352836 missense possibly damaging 0.83
R6074:Rp1 UTSW 1 4345379 missense probably benign 0.02
R6127:Rp1 UTSW 1 4349311 missense possibly damaging 0.80
R6187:Rp1 UTSW 1 4349869 missense probably damaging 1.00
R6301:Rp1 UTSW 1 4347254 missense probably benign 0.04
R6317:Rp1 UTSW 1 4041989 missense unknown
R6405:Rp1 UTSW 1 4345771 missense probably damaging 1.00
R6445:Rp1 UTSW 1 4226617 missense unknown
R6466:Rp1 UTSW 1 4347886 missense probably benign 0.01
R6501:Rp1 UTSW 1 4311280 intron probably benign
R6547:Rp1 UTSW 1 4170305 missense unknown
R6604:Rp1 UTSW 1 4019128 missense unknown
R6700:Rp1 UTSW 1 4349896 missense probably damaging 1.00
R6706:Rp1 UTSW 1 4142664 missense unknown
R6831:Rp1 UTSW 1 4349864 splice site probably null
R6918:Rp1 UTSW 1 3999608 missense unknown
R6973:Rp1 UTSW 1 4351994 nonsense probably null
R6981:Rp1 UTSW 1 4345655 missense probably benign 0.06
R7009:Rp1 UTSW 1 4042068 missense unknown
R7078:Rp1 UTSW 1 4206791 missense unknown
R7112:Rp1 UTSW 1 4349018 missense probably benign 0.43
R7135:Rp1 UTSW 1 4348168 missense possibly damaging 0.83
R7165:Rp1 UTSW 1 4349917 missense probably damaging 0.99
R7199:Rp1 UTSW 1 4347290 missense possibly damaging 0.73
R7232:Rp1 UTSW 1 4228601 missense unknown
R7367:Rp1 UTSW 1 4347998 missense probably benign 0.42
R7484:Rp1 UTSW 1 4345481 missense probably benign 0.10
R7500:Rp1 UTSW 1 4311278 missense unknown
R7569:Rp1 UTSW 1 4284840 missense unknown
R7642:Rp1 UTSW 1 4147831 missense unknown
R7693:Rp1 UTSW 1 4347403 missense probably damaging 1.00
R7742:Rp1 UTSW 1 4170234 missense unknown
R7759:Rp1 UTSW 1 4344884 missense probably benign
R7784:Rp1 UTSW 1 4142658 missense unknown
R7816:Rp1 UTSW 1 4347703 missense probably damaging 0.98
R7866:Rp1 UTSW 1 4347701 missense probably benign 0.02
R8215:Rp1 UTSW 1 4245095 missense unknown
R8281:Rp1 UTSW 1 4347916 missense probably damaging 1.00
R8294:Rp1 UTSW 1 4345997 missense probably benign 0.09
R8309:Rp1 UTSW 1 4347089 missense probably benign 0.00
R8311:Rp1 UTSW 1 4348349 missense probably benign 0.11
RF003:Rp1 UTSW 1 4344694 missense probably damaging 0.99
V1662:Rp1 UTSW 1 4349560 missense probably damaging 1.00
X0012:Rp1 UTSW 1 4347695 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CCACTAGCAATGACGTGGACAAAGG -3'
(R):5'- GTAACATCACTCACGGCGCACTTC -3'

Sequencing Primer
(F):5'- CTTTGATCCACTAAGTCAATCATGC -3'
(R):5'- GCACTTCAGGAAGGTGACTC -3'
Posted On2014-05-14