Incidental Mutation 'R1703:Vps18'
ID189861
Institutional Source Beutler Lab
Gene Symbol Vps18
Ensembl Gene ENSMUSG00000034216
Gene NameVPS18 CORVET/HOPS core subunit
Synonyms
MMRRC Submission 039736-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1703 (G1)
Quality Score214
Status Validated
Chromosome2
Chromosomal Location119288740-119298453 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 119289057 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 6 (D6E)
Ref Sequence ENSEMBL: ENSMUSP00000036915 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037280]
Predicted Effect probably benign
Transcript: ENSMUST00000037280
AA Change: D6E

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000036915
Gene: ENSMUSG00000034216
AA Change: D6E

DomainStartEndE-ValueType
Pfam:Pep3_Vps18 291 435 2.4e-41 PFAM
low complexity region 486 500 N/A INTRINSIC
Pfam:Clathrin 619 771 5.9e-11 PFAM
coiled coil region 803 845 N/A INTRINSIC
Blast:RING 853 947 3e-47 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119835
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139367
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151500
Meta Mutation Damage Score 0.0705 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.4%
Validation Efficiency 99% (86/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. This gene encodes the human homolog of yeast class C Vps18 protein. The mammalian class C Vps proteins are predominantly associated with late endosomes/lysosomes, and like their yeast counterparts, may mediate vesicle trafficking steps in the endosome/lysosome pathway. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a reporter allele exhibit preweaning lethality. Mice homozygous for a conditional allele activated in the nervous system exhibit impaired neuron migration and neurodegeneration associated with increased apoptosis and impaired autophagy and endocytosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057M21Rik A T 7: 131,343,702 Y401* probably null Het
4932415M13Rik C A 17: 53,725,037 noncoding transcript Het
Acoxl T A 2: 127,978,772 S81R probably damaging Het
Adamtsl4 A G 3: 95,677,614 C915R probably damaging Het
Adgra3 C T 5: 50,006,775 M287I probably benign Het
Afg1l T G 10: 42,400,399 D250A probably damaging Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Amfr T C 8: 93,974,243 T530A probably benign Het
Ank2 C T 3: 126,929,766 V971M probably damaging Het
App A G 16: 84,965,768 S656P probably damaging Het
Arid5a T A 1: 36,319,575 probably null Het
Asic5 T A 3: 81,999,722 V60D possibly damaging Het
Atm G T 9: 53,500,700 H1019N probably benign Het
Btbd11 A G 10: 85,387,384 D19G unknown Het
Cep250 A G 2: 155,965,546 K277R probably benign Het
Chrna7 C T 7: 63,099,507 R409H probably damaging Het
Chrng A T 1: 87,210,906 N419I possibly damaging Het
Ciao1 T C 2: 127,245,819 S199G probably benign Het
Clstn2 A T 9: 97,458,237 M694K possibly damaging Het
Cpeb2 A G 5: 43,233,838 probably benign Het
Cyp2c69 T A 19: 39,876,366 I223F probably benign Het
Dennd1b A T 1: 139,169,754 probably null Het
Dnah17 A T 11: 118,026,749 L4162Q probably damaging Het
Dnm1 T C 2: 32,323,451 M506V probably benign Het
Ecsit A G 9: 22,074,811 V173A probably damaging Het
Fam13b T C 18: 34,451,439 probably null Het
Fgl2 T A 5: 21,372,732 W6R possibly damaging Het
Galnt9 G A 5: 110,619,172 R503H probably damaging Het
Gm884 C T 11: 103,540,874 V1372I probably benign Het
Gramd1a C T 7: 31,139,534 V247M possibly damaging Het
Grip2 A T 6: 91,777,398 I632N probably damaging Het
Hspg2 T C 4: 137,559,151 V3627A probably damaging Het
Ipo8 T C 6: 148,789,892 Y660C probably benign Het
Isg15 T C 4: 156,199,808 R88G possibly damaging Het
Itgb5 T A 16: 33,910,500 D388E probably benign Het
Jhy T C 9: 40,944,837 Y118C probably damaging Het
Kalrn G A 16: 34,205,326 T931M probably damaging Het
Kif21a A G 15: 90,949,047 probably null Het
Lama2 A T 10: 27,266,671 Y604N probably damaging Het
Lrp3 T G 7: 35,213,161 S34R possibly damaging Het
Lyn T C 4: 3,738,867 probably null Het
Mroh8 C T 2: 157,271,976 V132I probably benign Het
Mthfd1l T C 10: 4,148,093 F977L probably damaging Het
Nol8 C T 13: 49,667,457 T912M possibly damaging Het
Nrxn1 A T 17: 90,208,417 N169K probably damaging Het
Olfr1118 T C 2: 87,309,410 V207A probably benign Het
Olfr1188 T A 2: 88,560,255 M262K possibly damaging Het
Oplah A G 15: 76,296,667 Y1279H probably benign Het
Pcsk5 T C 19: 17,752,094 N129S probably benign Het
Pcyt2 G T 11: 120,613,068 P185T probably benign Het
Pdlim2 A G 14: 70,174,335 probably null Het
Pgs1 T C 11: 118,014,728 probably benign Het
Qprt A G 7: 127,108,171 V251A probably benign Het
Rasal2 A C 1: 157,157,600 L834R probably damaging Het
Reg1 T C 6: 78,428,449 C161R probably damaging Het
Rp1 T A 1: 4,345,169 I1907F probably damaging Het
S1pr5 T C 9: 21,244,050 D360G possibly damaging Het
Sart3 C A 5: 113,752,219 V482F probably benign Het
Scarf2 A G 16: 17,802,849 E127G probably damaging Het
Serinc5 T C 13: 92,688,797 S245P probably damaging Het
Serpinc1 G T 1: 160,993,517 R57L probably damaging Het
Setd2 A G 9: 110,549,864 S632G probably benign Het
Sgca A T 11: 94,969,391 L307M probably damaging Het
Slc7a9 C A 7: 35,454,575 Q208K probably benign Het
Slfn10-ps C T 11: 83,030,043 noncoding transcript Het
Spam1 A T 6: 24,796,257 D69V probably damaging Het
Tanc1 A G 2: 59,843,021 E1490G probably benign Het
Tbc1d22a G T 15: 86,239,215 D150Y probably benign Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Tlx1 A G 19: 45,156,004 D55G possibly damaging Het
Tram2 G T 1: 21,004,234 N241K probably damaging Het
Ttc23l T C 15: 10,523,658 Y325C probably damaging Het
Ubac2 T A 14: 121,905,170 S27T probably benign Het
Utrn G A 10: 12,727,729 probably benign Het
Vnn3 A T 10: 23,865,930 M378L probably benign Het
Xkr5 T A 8: 18,939,118 I253F probably benign Het
Yeats4 A T 10: 117,215,723 C210S probably benign Het
Zdhhc20 A G 14: 57,839,088 probably null Het
Other mutations in Vps18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01627:Vps18 APN 2 119297191 missense probably benign 0.03
IGL02311:Vps18 APN 2 119290251 missense probably benign 0.05
IGL02332:Vps18 APN 2 119293810 missense probably benign 0.04
IGL03089:Vps18 APN 2 119293177 missense probably benign 0.01
IGL03114:Vps18 APN 2 119293651 missense possibly damaging 0.55
IGL03334:Vps18 APN 2 119297482 missense probably damaging 1.00
F5770:Vps18 UTSW 2 119297228 missense probably benign 0.22
R0311:Vps18 UTSW 2 119297365 missense probably benign 0.05
R0346:Vps18 UTSW 2 119297164 missense probably damaging 1.00
R0373:Vps18 UTSW 2 119293905 missense probably damaging 0.99
R0637:Vps18 UTSW 2 119293905 missense probably damaging 0.99
R1493:Vps18 UTSW 2 119297132 missense probably damaging 1.00
R1734:Vps18 UTSW 2 119293942 missense probably benign 0.01
R4297:Vps18 UTSW 2 119297331 nonsense probably null
R4633:Vps18 UTSW 2 119293276 missense probably damaging 1.00
R4729:Vps18 UTSW 2 119293791 missense probably damaging 1.00
R5034:Vps18 UTSW 2 119293306 missense probably benign 0.00
R5162:Vps18 UTSW 2 119292942 missense probably benign 0.19
R5320:Vps18 UTSW 2 119297377 nonsense probably null
R5857:Vps18 UTSW 2 119297533 missense probably damaging 1.00
R6105:Vps18 UTSW 2 119289062 missense probably damaging 1.00
R6150:Vps18 UTSW 2 119297592 nonsense probably null
R8018:Vps18 UTSW 2 119294011 missense probably damaging 1.00
R8147:Vps18 UTSW 2 119292756 missense probably benign 0.19
RF002:Vps18 UTSW 2 119297390 missense probably damaging 1.00
V7583:Vps18 UTSW 2 119297228 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- TGCCCAGGACTCCAGTTAACACTC -3'
(R):5'- GGCTTAGATCCTAAACACACGCTGC -3'

Sequencing Primer
(F):5'- TCTGCTAAGGGGAGCCTATAATC -3'
(R):5'- TAAACACACGCTGCAAGCTC -3'
Posted On2014-05-14