Incidental Mutation 'R1703:Gramd1a'
ID189883
Institutional Source Beutler Lab
Gene Symbol Gramd1a
Ensembl Gene ENSMUSG00000001248
Gene NameGRAM domain containing 1A
SynonymsD7Bwg0611e, 1300003M23Rik
MMRRC Submission 039736-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R1703 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location31130127-31155896 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 31139534 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 247 (V247M)
Ref Sequence ENSEMBL: ENSMUSP00000082778 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001280] [ENSMUST00000085636] [ENSMUST00000185514] [ENSMUST00000186634] [ENSMUST00000186723] [ENSMUST00000187679]
Predicted Effect possibly damaging
Transcript: ENSMUST00000001280
AA Change: V247M

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000001280
Gene: ENSMUSG00000001248
AA Change: V247M

DomainStartEndE-ValueType
low complexity region 8 39 N/A INTRINSIC
low complexity region 43 57 N/A INTRINSIC
GRAM 93 160 2.54e-29 SMART
low complexity region 342 360 N/A INTRINSIC
Pfam:DUF4782 372 520 7.3e-37 PFAM
low complexity region 531 542 N/A INTRINSIC
low complexity region 548 562 N/A INTRINSIC
transmembrane domain 606 628 N/A INTRINSIC
low complexity region 707 719 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000085636
AA Change: V247M

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000082778
Gene: ENSMUSG00000001248
AA Change: V247M

DomainStartEndE-ValueType
low complexity region 8 39 N/A INTRINSIC
low complexity region 43 57 N/A INTRINSIC
GRAM 93 160 2.54e-29 SMART
low complexity region 342 360 N/A INTRINSIC
Pfam:DUF4782 372 500 1.1e-28 PFAM
low complexity region 514 528 N/A INTRINSIC
transmembrane domain 572 594 N/A INTRINSIC
low complexity region 673 685 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185514
SMART Domains Protein: ENSMUSP00000139681
Gene: ENSMUSG00000001248

DomainStartEndE-ValueType
low complexity region 8 39 N/A INTRINSIC
low complexity region 43 57 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185985
Predicted Effect possibly damaging
Transcript: ENSMUST00000186634
AA Change: V247M

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000140195
Gene: ENSMUSG00000001248
AA Change: V247M

DomainStartEndE-ValueType
low complexity region 8 39 N/A INTRINSIC
low complexity region 43 57 N/A INTRINSIC
GRAM 93 160 8.9e-32 SMART
low complexity region 342 360 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186723
SMART Domains Protein: ENSMUSP00000139709
Gene: ENSMUSG00000001248

DomainStartEndE-ValueType
low complexity region 89 120 N/A INTRINSIC
low complexity region 124 138 N/A INTRINSIC
Pfam:GRAM 174 208 1e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000187679
SMART Domains Protein: ENSMUSP00000140674
Gene: ENSMUSG00000001248

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
GRAM 52 119 8.9e-32 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188032
Predicted Effect probably benign
Transcript: ENSMUST00000202814
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205298
Predicted Effect probably benign
Transcript: ENSMUST00000206233
Predicted Effect unknown
Transcript: ENSMUST00000206432
AA Change: V43M
Meta Mutation Damage Score 0.0975 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.4%
Validation Efficiency 99% (86/87)
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057M21Rik A T 7: 131,343,702 Y401* probably null Het
4932415M13Rik C A 17: 53,725,037 noncoding transcript Het
Acoxl T A 2: 127,978,772 S81R probably damaging Het
Adamtsl4 A G 3: 95,677,614 C915R probably damaging Het
Adgra3 C T 5: 50,006,775 M287I probably benign Het
Afg1l T G 10: 42,400,399 D250A probably damaging Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Amfr T C 8: 93,974,243 T530A probably benign Het
Ank2 C T 3: 126,929,766 V971M probably damaging Het
App A G 16: 84,965,768 S656P probably damaging Het
Arid5a T A 1: 36,319,575 probably null Het
Asic5 T A 3: 81,999,722 V60D possibly damaging Het
Atm G T 9: 53,500,700 H1019N probably benign Het
Btbd11 A G 10: 85,387,384 D19G unknown Het
Cep250 A G 2: 155,965,546 K277R probably benign Het
Chrna7 C T 7: 63,099,507 R409H probably damaging Het
Chrng A T 1: 87,210,906 N419I possibly damaging Het
Ciao1 T C 2: 127,245,819 S199G probably benign Het
Clstn2 A T 9: 97,458,237 M694K possibly damaging Het
Cpeb2 A G 5: 43,233,838 probably benign Het
Cyp2c69 T A 19: 39,876,366 I223F probably benign Het
Dennd1b A T 1: 139,169,754 probably null Het
Dnah17 A T 11: 118,026,749 L4162Q probably damaging Het
Dnm1 T C 2: 32,323,451 M506V probably benign Het
Ecsit A G 9: 22,074,811 V173A probably damaging Het
Fam13b T C 18: 34,451,439 probably null Het
Fgl2 T A 5: 21,372,732 W6R possibly damaging Het
Galnt9 G A 5: 110,619,172 R503H probably damaging Het
Gm884 C T 11: 103,540,874 V1372I probably benign Het
Grip2 A T 6: 91,777,398 I632N probably damaging Het
Hspg2 T C 4: 137,559,151 V3627A probably damaging Het
Ipo8 T C 6: 148,789,892 Y660C probably benign Het
Isg15 T C 4: 156,199,808 R88G possibly damaging Het
Itgb5 T A 16: 33,910,500 D388E probably benign Het
Jhy T C 9: 40,944,837 Y118C probably damaging Het
Kalrn G A 16: 34,205,326 T931M probably damaging Het
Kif21a A G 15: 90,949,047 probably null Het
Lama2 A T 10: 27,266,671 Y604N probably damaging Het
Lrp3 T G 7: 35,213,161 S34R possibly damaging Het
Lyn T C 4: 3,738,867 probably null Het
Mroh8 C T 2: 157,271,976 V132I probably benign Het
Mthfd1l T C 10: 4,148,093 F977L probably damaging Het
Nol8 C T 13: 49,667,457 T912M possibly damaging Het
Nrxn1 A T 17: 90,208,417 N169K probably damaging Het
Olfr1118 T C 2: 87,309,410 V207A probably benign Het
Olfr1188 T A 2: 88,560,255 M262K possibly damaging Het
Oplah A G 15: 76,296,667 Y1279H probably benign Het
Pcsk5 T C 19: 17,752,094 N129S probably benign Het
Pcyt2 G T 11: 120,613,068 P185T probably benign Het
Pdlim2 A G 14: 70,174,335 probably null Het
Pgs1 T C 11: 118,014,728 probably benign Het
Qprt A G 7: 127,108,171 V251A probably benign Het
Rasal2 A C 1: 157,157,600 L834R probably damaging Het
Reg1 T C 6: 78,428,449 C161R probably damaging Het
Rp1 T A 1: 4,345,169 I1907F probably damaging Het
S1pr5 T C 9: 21,244,050 D360G possibly damaging Het
Sart3 C A 5: 113,752,219 V482F probably benign Het
Scarf2 A G 16: 17,802,849 E127G probably damaging Het
Serinc5 T C 13: 92,688,797 S245P probably damaging Het
Serpinc1 G T 1: 160,993,517 R57L probably damaging Het
Setd2 A G 9: 110,549,864 S632G probably benign Het
Sgca A T 11: 94,969,391 L307M probably damaging Het
Slc7a9 C A 7: 35,454,575 Q208K probably benign Het
Slfn10-ps C T 11: 83,030,043 noncoding transcript Het
Spam1 A T 6: 24,796,257 D69V probably damaging Het
Tanc1 A G 2: 59,843,021 E1490G probably benign Het
Tbc1d22a G T 15: 86,239,215 D150Y probably benign Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Tlx1 A G 19: 45,156,004 D55G possibly damaging Het
Tram2 G T 1: 21,004,234 N241K probably damaging Het
Ttc23l T C 15: 10,523,658 Y325C probably damaging Het
Ubac2 T A 14: 121,905,170 S27T probably benign Het
Utrn G A 10: 12,727,729 probably benign Het
Vnn3 A T 10: 23,865,930 M378L probably benign Het
Vps18 T A 2: 119,289,057 D6E probably benign Het
Xkr5 T A 8: 18,939,118 I253F probably benign Het
Yeats4 A T 10: 117,215,723 C210S probably benign Het
Zdhhc20 A G 14: 57,839,088 probably null Het
Other mutations in Gramd1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01315:Gramd1a APN 7 31142568 missense probably damaging 0.99
IGL01627:Gramd1a APN 7 31139796 missense probably damaging 0.99
IGL01684:Gramd1a APN 7 31138905 missense possibly damaging 0.67
IGL01793:Gramd1a APN 7 31134413 critical splice donor site probably null
IGL01986:Gramd1a APN 7 31134009 missense possibly damaging 0.58
IGL02029:Gramd1a APN 7 31132824 missense possibly damaging 0.95
IGL02060:Gramd1a APN 7 31130571 nonsense probably null
IGL02569:Gramd1a APN 7 31130507 unclassified probably benign
IGL02606:Gramd1a APN 7 31134515 missense probably damaging 1.00
IGL02715:Gramd1a APN 7 31135854 missense probably damaging 1.00
IGL03253:Gramd1a APN 7 31139846 nonsense probably null
PIT4377001:Gramd1a UTSW 7 31143670 missense possibly damaging 0.95
PIT4618001:Gramd1a UTSW 7 31132596 missense probably benign 0.00
R0179:Gramd1a UTSW 7 31142418 missense probably damaging 1.00
R0329:Gramd1a UTSW 7 31138254 missense possibly damaging 0.93
R0330:Gramd1a UTSW 7 31138254 missense possibly damaging 0.93
R0628:Gramd1a UTSW 7 31142624 missense probably damaging 1.00
R0834:Gramd1a UTSW 7 31138164 missense possibly damaging 0.94
R1421:Gramd1a UTSW 7 31142866 missense probably damaging 0.98
R1430:Gramd1a UTSW 7 31132786 missense probably damaging 0.97
R1682:Gramd1a UTSW 7 31142900 splice site probably null
R1822:Gramd1a UTSW 7 31142573 missense probably damaging 1.00
R2308:Gramd1a UTSW 7 31139790 missense probably damaging 0.97
R3861:Gramd1a UTSW 7 31135940 missense possibly damaging 0.90
R4184:Gramd1a UTSW 7 31132515 intron probably benign
R4908:Gramd1a UTSW 7 31138867 missense probably benign 0.27
R4978:Gramd1a UTSW 7 31132788 missense possibly damaging 0.74
R5723:Gramd1a UTSW 7 31134483 missense probably damaging 1.00
R5927:Gramd1a UTSW 7 31139821 missense probably benign 0.33
R6466:Gramd1a UTSW 7 31143796 missense probably benign
R6838:Gramd1a UTSW 7 31134504 missense probably benign 0.30
R7034:Gramd1a UTSW 7 31132756 critical splice donor site probably null
R7036:Gramd1a UTSW 7 31132756 critical splice donor site probably null
R7867:Gramd1a UTSW 7 31143567 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTCTGCCGTATTTGCCCGGTTC -3'
(R):5'- TGAAGACGAAGACTATGTCTGCCCC -3'

Sequencing Primer
(F):5'- GCATCTCATCCCTCTGCCAAG -3'
(R):5'- GCCCCTTGCAACTGAATG -3'
Posted On2014-05-14