Incidental Mutation 'R1703:Atm'
Institutional Source Beutler Lab
Gene Symbol Atm
Ensembl Gene ENSMUSG00000034218
Gene Nameataxia telangiectasia mutated
MMRRC Submission 039736-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.864) question?
Stock #R1703 (G1)
Quality Score225
Status Validated
Chromosomal Location53439149-53536740 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 53500700 bp
Amino Acid Change Histidine to Asparagine at position 1019 (H1019N)
Ref Sequence ENSEMBL: ENSMUSP00000156344 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118282] [ENSMUST00000232179]
Predicted Effect probably benign
Transcript: ENSMUST00000118282
AA Change: H1019N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113388
Gene: ENSMUSG00000034218
AA Change: H1019N

TAN 1 166 5.07e-68 SMART
low complexity region 431 445 N/A INTRINSIC
low complexity region 830 846 N/A INTRINSIC
low complexity region 929 940 N/A INTRINSIC
SCOP:d1gw5a_ 1039 1568 2e-4 SMART
coiled coil region 1615 1644 N/A INTRINSIC
low complexity region 1650 1662 N/A INTRINSIC
Pfam:FAT 2102 2499 4.4e-50 PFAM
low complexity region 2587 2599 N/A INTRINSIC
PI3Kc 2723 3026 1.11e-117 SMART
FATC 3034 3066 3.71e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000232179
AA Change: H1019N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.4%
Validation Efficiency 99% (86/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the PI3/PI4-kinase family. This protein is an important cell cycle checkpoint kinase that phosphorylates; thus, it functions as a regulator of a wide variety of downstream proteins, including tumor suppressor proteins p53 and BRCA1, checkpoint kinase CHK2, checkpoint proteins RAD17 and RAD9, and DNA repair protein NBS1. This protein and the closely related kinase ATR are thought to be master controllers of cell cycle checkpoint signaling pathways that are required for cell response to DNA damage and for genome stability. Mutations in this gene are associated with ataxia telangiectasia, an autosomal recessive disorder. [provided by RefSeq, Aug 2010]
PHENOTYPE: Homozygotes for null mutations may exhibit locomotor abnormalities, motor learning deficits, growth retardation, sterility due to meiotic arrest, and susceptibility to thymic lymphomas. Mice homozygous for a kinase dead allele exhibit early embryonic lethality associated with genetic instability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057M21Rik A T 7: 131,343,702 Y401* probably null Het
4932415M13Rik C A 17: 53,725,037 noncoding transcript Het
Acoxl T A 2: 127,978,772 S81R probably damaging Het
Adamtsl4 A G 3: 95,677,614 C915R probably damaging Het
Adgra3 C T 5: 50,006,775 M287I probably benign Het
Afg1l T G 10: 42,400,399 D250A probably damaging Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Amfr T C 8: 93,974,243 T530A probably benign Het
Ank2 C T 3: 126,929,766 V971M probably damaging Het
App A G 16: 84,965,768 S656P probably damaging Het
Arid5a T A 1: 36,319,575 probably null Het
Asic5 T A 3: 81,999,722 V60D possibly damaging Het
Btbd11 A G 10: 85,387,384 D19G unknown Het
Cep250 A G 2: 155,965,546 K277R probably benign Het
Chrna7 C T 7: 63,099,507 R409H probably damaging Het
Chrng A T 1: 87,210,906 N419I possibly damaging Het
Ciao1 T C 2: 127,245,819 S199G probably benign Het
Clstn2 A T 9: 97,458,237 M694K possibly damaging Het
Cpeb2 A G 5: 43,233,838 probably benign Het
Cyp2c69 T A 19: 39,876,366 I223F probably benign Het
Dennd1b A T 1: 139,169,754 probably null Het
Dnah17 A T 11: 118,026,749 L4162Q probably damaging Het
Dnm1 T C 2: 32,323,451 M506V probably benign Het
Ecsit A G 9: 22,074,811 V173A probably damaging Het
Fam13b T C 18: 34,451,439 probably null Het
Fgl2 T A 5: 21,372,732 W6R possibly damaging Het
Galnt9 G A 5: 110,619,172 R503H probably damaging Het
Gm884 C T 11: 103,540,874 V1372I probably benign Het
Gramd1a C T 7: 31,139,534 V247M possibly damaging Het
Grip2 A T 6: 91,777,398 I632N probably damaging Het
Hspg2 T C 4: 137,559,151 V3627A probably damaging Het
Ipo8 T C 6: 148,789,892 Y660C probably benign Het
Isg15 T C 4: 156,199,808 R88G possibly damaging Het
Itgb5 T A 16: 33,910,500 D388E probably benign Het
Jhy T C 9: 40,944,837 Y118C probably damaging Het
Kalrn G A 16: 34,205,326 T931M probably damaging Het
Kif21a A G 15: 90,949,047 probably null Het
Lama2 A T 10: 27,266,671 Y604N probably damaging Het
Lrp3 T G 7: 35,213,161 S34R possibly damaging Het
Lyn T C 4: 3,738,867 probably null Het
Mroh8 C T 2: 157,271,976 V132I probably benign Het
Mthfd1l T C 10: 4,148,093 F977L probably damaging Het
Nol8 C T 13: 49,667,457 T912M possibly damaging Het
Nrxn1 A T 17: 90,208,417 N169K probably damaging Het
Olfr1118 T C 2: 87,309,410 V207A probably benign Het
Olfr1188 T A 2: 88,560,255 M262K possibly damaging Het
Oplah A G 15: 76,296,667 Y1279H probably benign Het
Pcsk5 T C 19: 17,752,094 N129S probably benign Het
Pcyt2 G T 11: 120,613,068 P185T probably benign Het
Pdlim2 A G 14: 70,174,335 probably null Het
Pgs1 T C 11: 118,014,728 probably benign Het
Qprt A G 7: 127,108,171 V251A probably benign Het
Rasal2 A C 1: 157,157,600 L834R probably damaging Het
Reg1 T C 6: 78,428,449 C161R probably damaging Het
Rp1 T A 1: 4,345,169 I1907F probably damaging Het
S1pr5 T C 9: 21,244,050 D360G possibly damaging Het
Sart3 C A 5: 113,752,219 V482F probably benign Het
Scarf2 A G 16: 17,802,849 E127G probably damaging Het
Serinc5 T C 13: 92,688,797 S245P probably damaging Het
Serpinc1 G T 1: 160,993,517 R57L probably damaging Het
Setd2 A G 9: 110,549,864 S632G probably benign Het
Sgca A T 11: 94,969,391 L307M probably damaging Het
Slc7a9 C A 7: 35,454,575 Q208K probably benign Het
Slfn10-ps C T 11: 83,030,043 noncoding transcript Het
Spam1 A T 6: 24,796,257 D69V probably damaging Het
Tanc1 A G 2: 59,843,021 E1490G probably benign Het
Tbc1d22a G T 15: 86,239,215 D150Y probably benign Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Tlx1 A G 19: 45,156,004 D55G possibly damaging Het
Tram2 G T 1: 21,004,234 N241K probably damaging Het
Ttc23l T C 15: 10,523,658 Y325C probably damaging Het
Ubac2 T A 14: 121,905,170 S27T probably benign Het
Utrn G A 10: 12,727,729 probably benign Het
Vnn3 A T 10: 23,865,930 M378L probably benign Het
Vps18 T A 2: 119,289,057 D6E probably benign Het
Xkr5 T A 8: 18,939,118 I253F probably benign Het
Yeats4 A T 10: 117,215,723 C210S probably benign Het
Zdhhc20 A G 14: 57,839,088 probably null Het
Other mutations in Atm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Atm APN 9 53524443 missense probably damaging 1.00
IGL00466:Atm APN 9 53499112 splice site probably benign
IGL00567:Atm APN 9 53503116 nonsense probably null
IGL00702:Atm APN 9 53511831 missense probably benign 0.02
IGL00743:Atm APN 9 53513116 missense probably benign 0.00
IGL00771:Atm APN 9 53493054 missense probably benign 0.01
IGL00773:Atm APN 9 53522144 missense probably benign 0.00
IGL00819:Atm APN 9 53518531 missense probably damaging 1.00
IGL00864:Atm APN 9 53533933 missense probably damaging 0.99
IGL00985:Atm APN 9 53459816 missense probably damaging 0.98
IGL01109:Atm APN 9 53490293 missense probably damaging 1.00
IGL01120:Atm APN 9 53461122 critical splice acceptor site probably null
IGL01369:Atm APN 9 53515317 missense probably benign
IGL01374:Atm APN 9 53531724 missense possibly damaging 0.58
IGL01406:Atm APN 9 53439746 makesense probably null
IGL01409:Atm APN 9 53499171 missense probably benign 0.01
IGL01434:Atm APN 9 53507807 missense probably benign 0.04
IGL01486:Atm APN 9 53510213 missense probably benign
IGL01583:Atm APN 9 53484247 splice site probably benign
IGL01861:Atm APN 9 53494612 missense probably null 0.89
IGL01865:Atm APN 9 53461002 missense probably damaging 1.00
IGL02026:Atm APN 9 53442417 splice site probably null
IGL02072:Atm APN 9 53459796 missense probably benign 0.01
IGL02075:Atm APN 9 53527237 missense probably damaging 1.00
IGL02127:Atm APN 9 53487983 missense probably damaging 1.00
IGL02175:Atm APN 9 53480665 missense probably damaging 0.99
IGL02246:Atm APN 9 53527185 missense probably benign 0.12
IGL02259:Atm APN 9 53518494 splice site probably benign
IGL02351:Atm APN 9 53522176 missense probably benign 0.04
IGL02358:Atm APN 9 53522176 missense probably benign 0.04
IGL02387:Atm APN 9 53479766 splice site probably null
IGL02417:Atm APN 9 53479695 missense probably benign 0.00
IGL02422:Atm APN 9 53500792 missense probably damaging 1.00
IGL02445:Atm APN 9 53454330 missense probably benign 0.00
IGL02492:Atm APN 9 53455859 missense probably damaging 0.99
IGL02513:Atm APN 9 53497262 splice site probably benign
IGL02633:Atm APN 9 53448153 missense probably damaging 1.00
IGL02634:Atm APN 9 53516563 missense probably benign 0.00
IGL02948:Atm APN 9 53453440 splice site probably benign
IGL02959:Atm APN 9 53471418 missense probably damaging 1.00
IGL02965:Atm APN 9 53453563 missense probably damaging 1.00
IGL03085:Atm APN 9 53484171 missense possibly damaging 0.89
antebellum UTSW 9 53518559 nonsense probably null
bull_run UTSW 9 53487922 missense probably benign 0.09
Civil UTSW 9 53492268 missense possibly damaging 0.78
gettysburg UTSW 9 53455988 splice site probably null
Grant UTSW 9 53511917 nonsense probably null
mockingbird UTSW 9 53516467 nonsense probably null
mockingbird2 UTSW 9 53488587 missense probably damaging 1.00
osphere UTSW 9 53479673 missense probably damaging 0.99
shiloh UTSW 9 53465298 missense probably damaging 1.00
Strato UTSW 9 53503018 missense probably damaging 1.00
thrasher UTSW 9 53445507 missense probably benign 0.01
Tropo UTSW 9 53531648 missense probably damaging 1.00
P0019:Atm UTSW 9 53465028 splice site probably benign
PIT4403001:Atm UTSW 9 53500982 missense probably benign
PIT4687001:Atm UTSW 9 53486812 critical splice donor site probably null
R0004:Atm UTSW 9 53453528 splice site probably benign
R0035:Atm UTSW 9 53513180 missense probably benign 0.01
R0098:Atm UTSW 9 53518569 missense probably benign 0.10
R0098:Atm UTSW 9 53518569 missense probably benign 0.10
R0201:Atm UTSW 9 53454279 splice site probably benign
R0304:Atm UTSW 9 53516344 missense probably benign 0.34
R0308:Atm UTSW 9 53454473 splice site probably null
R0362:Atm UTSW 9 53458838 missense possibly damaging 0.90
R0470:Atm UTSW 9 53460966 missense probably damaging 1.00
R0513:Atm UTSW 9 53503948 missense probably benign 0.00
R0589:Atm UTSW 9 53490192 missense possibly damaging 0.51
R0617:Atm UTSW 9 53458941 nonsense probably null
R0630:Atm UTSW 9 53531622 splice site probably benign
R0652:Atm UTSW 9 53486014 missense probably damaging 0.98
R0698:Atm UTSW 9 53515239 missense probably damaging 1.00
R0737:Atm UTSW 9 53456566 missense probably damaging 1.00
R0885:Atm UTSW 9 53459823 missense probably benign
R0947:Atm UTSW 9 53504092 missense probably benign 0.01
R0948:Atm UTSW 9 53495958 missense probably benign
R1144:Atm UTSW 9 53511698 splice site probably benign
R1252:Atm UTSW 9 53455840 missense probably damaging 1.00
R1295:Atm UTSW 9 53456530 missense probably damaging 1.00
R1296:Atm UTSW 9 53456530 missense probably damaging 1.00
R1419:Atm UTSW 9 53457489 missense probably benign 0.00
R1477:Atm UTSW 9 53464273 missense probably benign 0.00
R1596:Atm UTSW 9 53453378 missense probably damaging 1.00
R1630:Atm UTSW 9 53479673 missense probably damaging 0.99
R1667:Atm UTSW 9 53500932 missense probably damaging 1.00
R1681:Atm UTSW 9 53522155 missense possibly damaging 0.94
R1817:Atm UTSW 9 53492233 splice site probably benign
R1840:Atm UTSW 9 53456530 missense probably damaging 1.00
R1848:Atm UTSW 9 53468012 missense probably benign 0.06
R1906:Atm UTSW 9 53506568 missense probably damaging 1.00
R1958:Atm UTSW 9 53471418 missense probably damaging 1.00
R2108:Atm UTSW 9 53443997 missense probably damaging 1.00
R2116:Atm UTSW 9 53500969 missense probably benign 0.36
R2134:Atm UTSW 9 53467964 critical splice donor site probably null
R2137:Atm UTSW 9 53453375 missense probably damaging 1.00
R2291:Atm UTSW 9 53490909 splice site probably null
R2348:Atm UTSW 9 53492268 missense possibly damaging 0.78
R2483:Atm UTSW 9 53510266 missense probably damaging 1.00
R2567:Atm UTSW 9 53457470 missense possibly damaging 0.72
R2897:Atm UTSW 9 53507805 missense probably damaging 0.99
R2939:Atm UTSW 9 53494711 missense probably damaging 1.00
R3008:Atm UTSW 9 53480750 missense probably benign 0.00
R3236:Atm UTSW 9 53479748 missense probably benign 0.15
R3847:Atm UTSW 9 53503075 missense possibly damaging 0.94
R3889:Atm UTSW 9 53506636 splice site probably benign
R3919:Atm UTSW 9 53492278 missense probably benign 0.00
R4125:Atm UTSW 9 53450621 missense probably damaging 1.00
R4222:Atm UTSW 9 53480669 missense probably benign
R4395:Atm UTSW 9 53465227 missense probably benign 0.09
R4466:Atm UTSW 9 53448169 nonsense probably null
R4502:Atm UTSW 9 53495946 missense possibly damaging 0.92
R4514:Atm UTSW 9 53493039 missense probably damaging 0.99
R4528:Atm UTSW 9 53500759 missense probably benign 0.39
R4593:Atm UTSW 9 53453594 missense possibly damaging 0.55
R4627:Atm UTSW 9 53456506 missense possibly damaging 0.79
R4634:Atm UTSW 9 53531733 missense probably benign 0.01
R4665:Atm UTSW 9 53464229 missense probably benign 0.00
R4672:Atm UTSW 9 53522201 missense probably damaging 0.99
R4741:Atm UTSW 9 53453607 missense probably benign 0.10
R4808:Atm UTSW 9 53445495 missense probably damaging 0.99
R4959:Atm UTSW 9 53515301 missense probably benign
R4996:Atm UTSW 9 53524507 missense probably benign 0.09
R5030:Atm UTSW 9 53520109 nonsense probably null
R5214:Atm UTSW 9 53491027 missense probably benign 0.09
R5260:Atm UTSW 9 53506611 missense probably damaging 0.99
R5311:Atm UTSW 9 53518623 missense probably benign 0.00
R5394:Atm UTSW 9 53507777 critical splice donor site probably null
R5400:Atm UTSW 9 53503018 missense probably damaging 1.00
R5436:Atm UTSW 9 53459804 missense probably benign 0.00
R5441:Atm UTSW 9 53516467 nonsense probably null
R5569:Atm UTSW 9 53516450 nonsense probably null
R5856:Atm UTSW 9 53495955 missense possibly damaging 0.64
R5891:Atm UTSW 9 53497159 missense probably benign
R5910:Atm UTSW 9 53448080 missense probably damaging 0.96
R6054:Atm UTSW 9 53459873 missense probably damaging 1.00
R6062:Atm UTSW 9 53488587 missense probably damaging 1.00
R6092:Atm UTSW 9 53524414 missense probably damaging 1.00
R6127:Atm UTSW 9 53524509 missense probably damaging 1.00
R6160:Atm UTSW 9 53490959 missense probably benign 0.04
R6267:Atm UTSW 9 53444000 missense probably damaging 1.00
R6273:Atm UTSW 9 53487922 missense probably benign 0.09
R6284:Atm UTSW 9 53445376 splice site probably null
R6478:Atm UTSW 9 53490254 missense probably damaging 1.00
R6547:Atm UTSW 9 53440157 missense probably damaging 1.00
R6549:Atm UTSW 9 53493177 missense probably benign 0.00
R6704:Atm UTSW 9 53458853 missense probably benign 0.02
R6715:Atm UTSW 9 53531648 missense probably damaging 1.00
R6737:Atm UTSW 9 53486051 missense probably benign 0.30
R6759:Atm UTSW 9 53518559 nonsense probably null
R6766:Atm UTSW 9 53490282 missense probably damaging 0.99
R6813:Atm UTSW 9 53497235 missense probably benign 0.00
R6852:Atm UTSW 9 53482430 missense possibly damaging 0.93
R7064:Atm UTSW 9 53507881 missense probably benign 0.02
R7208:Atm UTSW 9 53512008 splice site probably null
R7211:Atm UTSW 9 53488560 missense probably benign 0.01
R7220:Atm UTSW 9 53511917 nonsense probably null
R7336:Atm UTSW 9 53462503 missense possibly damaging 0.47
R7363:Atm UTSW 9 53465298 missense probably damaging 1.00
R7378:Atm UTSW 9 53453437 critical splice acceptor site probably null
R7472:Atm UTSW 9 53448125 missense possibly damaging 0.81
R7487:Atm UTSW 9 53524354 missense probably benign
R7497:Atm UTSW 9 53511891 missense probably benign 0.00
R7584:Atm UTSW 9 53513127 missense probably damaging 0.99
R7624:Atm UTSW 9 53454768 missense probably damaging 0.99
R7653:Atm UTSW 9 53490302 nonsense probably null
R7660:Atm UTSW 9 53445507 missense probably benign 0.01
R7679:Atm UTSW 9 53442497 missense probably damaging 1.00
R7720:Atm UTSW 9 53522239 missense possibly damaging 0.54
R8221:Atm UTSW 9 53455988 splice site probably null
R8247:Atm UTSW 9 53450570 missense
R8334:Atm UTSW 9 53522273 missense probably benign 0.00
R8503:Atm UTSW 9 53488052 missense probably damaging 0.99
R8552:Atm UTSW 9 53524497 missense probably damaging 1.00
R8749:Atm UTSW 9 53499197 nonsense probably null
X0067:Atm UTSW 9 53479694 missense probably benign 0.00
Z1088:Atm UTSW 9 53531687 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- actgaggactgaaacccaac -3'
Posted On2014-05-14