Incidental Mutation 'R1703:Atm'
ID 189894
Institutional Source Beutler Lab
Gene Symbol Atm
Ensembl Gene ENSMUSG00000034218
Gene Name ataxia telangiectasia mutated
Synonyms C030026E19Rik
MMRRC Submission 039736-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.928) question?
Stock # R1703 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 53439149-53536740 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 53500700 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Asparagine at position 1019 (H1019N)
Ref Sequence ENSEMBL: ENSMUSP00000156344 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118282] [ENSMUST00000232179]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000118282
AA Change: H1019N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113388
Gene: ENSMUSG00000034218
AA Change: H1019N

DomainStartEndE-ValueType
TAN 1 166 5.07e-68 SMART
low complexity region 431 445 N/A INTRINSIC
low complexity region 830 846 N/A INTRINSIC
low complexity region 929 940 N/A INTRINSIC
SCOP:d1gw5a_ 1039 1568 2e-4 SMART
coiled coil region 1615 1644 N/A INTRINSIC
low complexity region 1650 1662 N/A INTRINSIC
Pfam:FAT 2102 2499 4.4e-50 PFAM
low complexity region 2587 2599 N/A INTRINSIC
PI3Kc 2723 3026 1.11e-117 SMART
FATC 3034 3066 3.71e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000232179
AA Change: H1019N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.4%
Validation Efficiency 99% (86/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the PI3/PI4-kinase family. This protein is an important cell cycle checkpoint kinase that phosphorylates; thus, it functions as a regulator of a wide variety of downstream proteins, including tumor suppressor proteins p53 and BRCA1, checkpoint kinase CHK2, checkpoint proteins RAD17 and RAD9, and DNA repair protein NBS1. This protein and the closely related kinase ATR are thought to be master controllers of cell cycle checkpoint signaling pathways that are required for cell response to DNA damage and for genome stability. Mutations in this gene are associated with ataxia telangiectasia, an autosomal recessive disorder. [provided by RefSeq, Aug 2010]
PHENOTYPE: Homozygotes for null mutations may exhibit locomotor abnormalities, motor learning deficits, growth retardation, sterility due to meiotic arrest, and susceptibility to thymic lymphomas. Mice homozygous for a kinase dead allele exhibit early embryonic lethality associated with genetic instability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057M21Rik A T 7: 131,343,702 (GRCm38) Y401* probably null Het
4932415M13Rik C A 17: 53,725,037 (GRCm38) noncoding transcript Het
Acoxl T A 2: 127,978,772 (GRCm38) S81R probably damaging Het
Adamtsl4 A G 3: 95,677,614 (GRCm38) C915R probably damaging Het
Adgra3 C T 5: 50,006,775 (GRCm38) M287I probably benign Het
Afg1l T G 10: 42,400,399 (GRCm38) D250A probably damaging Het
Akap8l C T 17: 32,332,483 (GRCm38) R511H probably damaging Het
Amfr T C 8: 93,974,243 (GRCm38) T530A probably benign Het
Ank2 C T 3: 126,929,766 (GRCm38) V971M probably damaging Het
App A G 16: 84,965,768 (GRCm38) S656P probably damaging Het
Arid5a T A 1: 36,319,575 (GRCm38) probably null Het
Asic5 T A 3: 81,999,722 (GRCm38) V60D possibly damaging Het
Btbd11 A G 10: 85,387,384 (GRCm38) D19G unknown Het
Cep250 A G 2: 155,965,546 (GRCm38) K277R probably benign Het
Chrna7 C T 7: 63,099,507 (GRCm38) R409H probably damaging Het
Chrng A T 1: 87,210,906 (GRCm38) N419I possibly damaging Het
Ciao1 T C 2: 127,245,819 (GRCm38) S199G probably benign Het
Clstn2 A T 9: 97,458,237 (GRCm38) M694K possibly damaging Het
Cpeb2 A G 5: 43,233,838 (GRCm38) probably benign Het
Cyp2c69 T A 19: 39,876,366 (GRCm38) I223F probably benign Het
Dennd1b A T 1: 139,169,754 (GRCm38) probably null Het
Dnah17 A T 11: 118,026,749 (GRCm38) L4162Q probably damaging Het
Dnm1 T C 2: 32,323,451 (GRCm38) M506V probably benign Het
Ecsit A G 9: 22,074,811 (GRCm38) V173A probably damaging Het
Fam13b T C 18: 34,451,439 (GRCm38) probably null Het
Fgl2 T A 5: 21,372,732 (GRCm38) W6R possibly damaging Het
Galnt9 G A 5: 110,619,172 (GRCm38) R503H probably damaging Het
Gm884 C T 11: 103,540,874 (GRCm38) V1372I probably benign Het
Gramd1a C T 7: 31,139,534 (GRCm38) V247M possibly damaging Het
Grip2 A T 6: 91,777,398 (GRCm38) I632N probably damaging Het
Hspg2 T C 4: 137,559,151 (GRCm38) V3627A probably damaging Het
Ipo8 T C 6: 148,789,892 (GRCm38) Y660C probably benign Het
Isg15 T C 4: 156,199,808 (GRCm38) R88G possibly damaging Het
Itgb5 T A 16: 33,910,500 (GRCm38) D388E probably benign Het
Jhy T C 9: 40,944,837 (GRCm38) Y118C probably damaging Het
Kalrn G A 16: 34,205,326 (GRCm38) T931M probably damaging Het
Kif21a A G 15: 90,949,047 (GRCm38) probably null Het
Lama2 A T 10: 27,266,671 (GRCm38) Y604N probably damaging Het
Lrp3 T G 7: 35,213,161 (GRCm38) S34R possibly damaging Het
Lyn T C 4: 3,738,867 (GRCm38) probably null Het
Mroh8 C T 2: 157,271,976 (GRCm38) V132I probably benign Het
Mthfd1l T C 10: 4,148,093 (GRCm38) F977L probably damaging Het
Nol8 C T 13: 49,667,457 (GRCm38) T912M possibly damaging Het
Nrxn1 A T 17: 90,208,417 (GRCm38) N169K probably damaging Het
Olfr1118 T C 2: 87,309,410 (GRCm38) V207A probably benign Het
Olfr1188 T A 2: 88,560,255 (GRCm38) M262K possibly damaging Het
Oplah A G 15: 76,296,667 (GRCm38) Y1279H probably benign Het
Pcsk5 T C 19: 17,752,094 (GRCm38) N129S probably benign Het
Pcyt2 G T 11: 120,613,068 (GRCm38) P185T probably benign Het
Pdlim2 A G 14: 70,174,335 (GRCm38) probably null Het
Pgs1 T C 11: 118,014,728 (GRCm38) probably benign Het
Qprt A G 7: 127,108,171 (GRCm38) V251A probably benign Het
Rasal2 A C 1: 157,157,600 (GRCm38) L834R probably damaging Het
Reg1 T C 6: 78,428,449 (GRCm38) C161R probably damaging Het
Rp1 T A 1: 4,345,169 (GRCm38) I1907F probably damaging Het
S1pr5 T C 9: 21,244,050 (GRCm38) D360G possibly damaging Het
Sart3 C A 5: 113,752,219 (GRCm38) V482F probably benign Het
Scarf2 A G 16: 17,802,849 (GRCm38) E127G probably damaging Het
Serinc5 T C 13: 92,688,797 (GRCm38) S245P probably damaging Het
Serpinc1 G T 1: 160,993,517 (GRCm38) R57L probably damaging Het
Setd2 A G 9: 110,549,864 (GRCm38) S632G probably benign Het
Sgca A T 11: 94,969,391 (GRCm38) L307M probably damaging Het
Slc7a9 C A 7: 35,454,575 (GRCm38) Q208K probably benign Het
Slfn10-ps C T 11: 83,030,043 (GRCm38) noncoding transcript Het
Spam1 A T 6: 24,796,257 (GRCm38) D69V probably damaging Het
Tanc1 A G 2: 59,843,021 (GRCm38) E1490G probably benign Het
Tbc1d22a G T 15: 86,239,215 (GRCm38) D150Y probably benign Het
Tex10 C T 4: 48,456,800 (GRCm38) R637Q probably benign Het
Tlx1 A G 19: 45,156,004 (GRCm38) D55G possibly damaging Het
Tram2 G T 1: 21,004,234 (GRCm38) N241K probably damaging Het
Ttc23l T C 15: 10,523,658 (GRCm38) Y325C probably damaging Het
Ubac2 T A 14: 121,905,170 (GRCm38) S27T probably benign Het
Utrn G A 10: 12,727,729 (GRCm38) probably benign Het
Vnn3 A T 10: 23,865,930 (GRCm38) M378L probably benign Het
Vps18 T A 2: 119,289,057 (GRCm38) D6E probably benign Het
Xkr5 T A 8: 18,939,118 (GRCm38) I253F probably benign Het
Yeats4 A T 10: 117,215,723 (GRCm38) C210S probably benign Het
Zdhhc20 A G 14: 57,839,088 (GRCm38) probably null Het
Other mutations in Atm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Atm APN 9 53,524,443 (GRCm38) missense probably damaging 1.00
IGL00466:Atm APN 9 53,499,112 (GRCm38) splice site probably benign
IGL00567:Atm APN 9 53,503,116 (GRCm38) nonsense probably null
IGL00702:Atm APN 9 53,511,831 (GRCm38) missense probably benign 0.02
IGL00743:Atm APN 9 53,513,116 (GRCm38) missense probably benign 0.00
IGL00771:Atm APN 9 53,493,054 (GRCm38) missense probably benign 0.01
IGL00773:Atm APN 9 53,522,144 (GRCm38) missense probably benign 0.00
IGL00819:Atm APN 9 53,518,531 (GRCm38) missense probably damaging 1.00
IGL00864:Atm APN 9 53,533,933 (GRCm38) missense probably damaging 0.99
IGL00985:Atm APN 9 53,459,816 (GRCm38) missense probably damaging 0.98
IGL01109:Atm APN 9 53,490,293 (GRCm38) missense probably damaging 1.00
IGL01120:Atm APN 9 53,461,122 (GRCm38) critical splice acceptor site probably null
IGL01369:Atm APN 9 53,515,317 (GRCm38) missense probably benign
IGL01374:Atm APN 9 53,531,724 (GRCm38) missense possibly damaging 0.58
IGL01406:Atm APN 9 53,439,746 (GRCm38) makesense probably null
IGL01409:Atm APN 9 53,499,171 (GRCm38) missense probably benign 0.01
IGL01434:Atm APN 9 53,507,807 (GRCm38) missense probably benign 0.04
IGL01486:Atm APN 9 53,510,213 (GRCm38) missense probably benign
IGL01583:Atm APN 9 53,484,247 (GRCm38) splice site probably benign
IGL01861:Atm APN 9 53,494,612 (GRCm38) missense probably null 0.89
IGL01865:Atm APN 9 53,461,002 (GRCm38) missense probably damaging 1.00
IGL02026:Atm APN 9 53,442,417 (GRCm38) splice site probably null
IGL02072:Atm APN 9 53,459,796 (GRCm38) missense probably benign 0.01
IGL02075:Atm APN 9 53,527,237 (GRCm38) missense probably damaging 1.00
IGL02127:Atm APN 9 53,487,983 (GRCm38) missense probably damaging 1.00
IGL02175:Atm APN 9 53,480,665 (GRCm38) missense probably damaging 0.99
IGL02246:Atm APN 9 53,527,185 (GRCm38) missense probably benign 0.12
IGL02259:Atm APN 9 53,518,494 (GRCm38) splice site probably benign
IGL02351:Atm APN 9 53,522,176 (GRCm38) missense probably benign 0.04
IGL02358:Atm APN 9 53,522,176 (GRCm38) missense probably benign 0.04
IGL02387:Atm APN 9 53,479,766 (GRCm38) splice site probably null
IGL02417:Atm APN 9 53,479,695 (GRCm38) missense probably benign 0.00
IGL02422:Atm APN 9 53,500,792 (GRCm38) missense probably damaging 1.00
IGL02445:Atm APN 9 53,454,330 (GRCm38) missense probably benign 0.00
IGL02492:Atm APN 9 53,455,859 (GRCm38) missense probably damaging 0.99
IGL02513:Atm APN 9 53,497,262 (GRCm38) splice site probably benign
IGL02633:Atm APN 9 53,448,153 (GRCm38) missense probably damaging 1.00
IGL02634:Atm APN 9 53,516,563 (GRCm38) missense probably benign 0.00
IGL02948:Atm APN 9 53,453,440 (GRCm38) splice site probably benign
IGL02959:Atm APN 9 53,471,418 (GRCm38) missense probably damaging 1.00
IGL02965:Atm APN 9 53,453,563 (GRCm38) missense probably damaging 1.00
IGL03085:Atm APN 9 53,484,171 (GRCm38) missense possibly damaging 0.89
antebellum UTSW 9 53,518,559 (GRCm38) nonsense probably null
bull_run UTSW 9 53,487,922 (GRCm38) missense probably benign 0.09
Civil UTSW 9 53,492,268 (GRCm38) missense possibly damaging 0.78
gettysburg UTSW 9 53,455,988 (GRCm38) splice site probably null
Grant UTSW 9 53,511,917 (GRCm38) nonsense probably null
Indicative UTSW 9 53,445,376 (GRCm38) splice site probably null
Marker UTSW 9 53,454,279 (GRCm38) splice site probably benign
maunder UTSW 9 53,499,197 (GRCm38) nonsense probably null
mockingbird UTSW 9 53,516,467 (GRCm38) nonsense probably null
mockingbird2 UTSW 9 53,488,587 (GRCm38) missense probably damaging 1.00
osphere UTSW 9 53,479,673 (GRCm38) missense probably damaging 0.99
shiloh UTSW 9 53,465,298 (GRCm38) missense probably damaging 1.00
Strato UTSW 9 53,503,018 (GRCm38) missense probably damaging 1.00
thrasher UTSW 9 53,445,507 (GRCm38) missense probably benign 0.01
Tropo UTSW 9 53,531,648 (GRCm38) missense probably damaging 1.00
P0019:Atm UTSW 9 53,465,028 (GRCm38) splice site probably benign
PIT4403001:Atm UTSW 9 53,500,982 (GRCm38) missense probably benign
PIT4687001:Atm UTSW 9 53,486,812 (GRCm38) critical splice donor site probably null
R0004:Atm UTSW 9 53,453,528 (GRCm38) splice site probably benign
R0035:Atm UTSW 9 53,513,180 (GRCm38) missense probably benign 0.01
R0098:Atm UTSW 9 53,518,569 (GRCm38) missense probably benign 0.10
R0098:Atm UTSW 9 53,518,569 (GRCm38) missense probably benign 0.10
R0201:Atm UTSW 9 53,454,279 (GRCm38) splice site probably benign
R0304:Atm UTSW 9 53,516,344 (GRCm38) missense probably benign 0.34
R0308:Atm UTSW 9 53,454,473 (GRCm38) splice site probably null
R0362:Atm UTSW 9 53,458,838 (GRCm38) missense possibly damaging 0.90
R0470:Atm UTSW 9 53,460,966 (GRCm38) missense probably damaging 1.00
R0513:Atm UTSW 9 53,503,948 (GRCm38) missense probably benign 0.00
R0589:Atm UTSW 9 53,490,192 (GRCm38) missense possibly damaging 0.51
R0617:Atm UTSW 9 53,458,941 (GRCm38) nonsense probably null
R0630:Atm UTSW 9 53,531,622 (GRCm38) splice site probably benign
R0652:Atm UTSW 9 53,486,014 (GRCm38) missense probably damaging 0.98
R0698:Atm UTSW 9 53,515,239 (GRCm38) missense probably damaging 1.00
R0737:Atm UTSW 9 53,456,566 (GRCm38) missense probably damaging 1.00
R0885:Atm UTSW 9 53,459,823 (GRCm38) missense probably benign
R0947:Atm UTSW 9 53,504,092 (GRCm38) missense probably benign 0.01
R0948:Atm UTSW 9 53,495,958 (GRCm38) missense probably benign
R1144:Atm UTSW 9 53,511,698 (GRCm38) splice site probably benign
R1252:Atm UTSW 9 53,455,840 (GRCm38) missense probably damaging 1.00
R1295:Atm UTSW 9 53,456,530 (GRCm38) missense probably damaging 1.00
R1296:Atm UTSW 9 53,456,530 (GRCm38) missense probably damaging 1.00
R1419:Atm UTSW 9 53,457,489 (GRCm38) missense probably benign 0.00
R1477:Atm UTSW 9 53,464,273 (GRCm38) missense probably benign 0.00
R1596:Atm UTSW 9 53,453,378 (GRCm38) missense probably damaging 1.00
R1630:Atm UTSW 9 53,479,673 (GRCm38) missense probably damaging 0.99
R1667:Atm UTSW 9 53,500,932 (GRCm38) missense probably damaging 1.00
R1681:Atm UTSW 9 53,522,155 (GRCm38) missense possibly damaging 0.94
R1817:Atm UTSW 9 53,492,233 (GRCm38) splice site probably benign
R1840:Atm UTSW 9 53,456,530 (GRCm38) missense probably damaging 1.00
R1848:Atm UTSW 9 53,468,012 (GRCm38) missense probably benign 0.06
R1906:Atm UTSW 9 53,506,568 (GRCm38) missense probably damaging 1.00
R1958:Atm UTSW 9 53,471,418 (GRCm38) missense probably damaging 1.00
R2108:Atm UTSW 9 53,443,997 (GRCm38) missense probably damaging 1.00
R2116:Atm UTSW 9 53,500,969 (GRCm38) missense probably benign 0.36
R2134:Atm UTSW 9 53,467,964 (GRCm38) critical splice donor site probably null
R2137:Atm UTSW 9 53,453,375 (GRCm38) missense probably damaging 1.00
R2291:Atm UTSW 9 53,490,909 (GRCm38) splice site probably null
R2348:Atm UTSW 9 53,492,268 (GRCm38) missense possibly damaging 0.78
R2483:Atm UTSW 9 53,510,266 (GRCm38) missense probably damaging 1.00
R2567:Atm UTSW 9 53,457,470 (GRCm38) missense possibly damaging 0.72
R2897:Atm UTSW 9 53,507,805 (GRCm38) missense probably damaging 0.99
R2939:Atm UTSW 9 53,494,711 (GRCm38) missense probably damaging 1.00
R3008:Atm UTSW 9 53,480,750 (GRCm38) missense probably benign 0.00
R3236:Atm UTSW 9 53,479,748 (GRCm38) missense probably benign 0.15
R3847:Atm UTSW 9 53,503,075 (GRCm38) missense possibly damaging 0.94
R3889:Atm UTSW 9 53,506,636 (GRCm38) splice site probably benign
R3919:Atm UTSW 9 53,492,278 (GRCm38) missense probably benign 0.00
R4125:Atm UTSW 9 53,450,621 (GRCm38) missense probably damaging 1.00
R4222:Atm UTSW 9 53,480,669 (GRCm38) missense probably benign
R4395:Atm UTSW 9 53,465,227 (GRCm38) missense probably benign 0.09
R4466:Atm UTSW 9 53,448,169 (GRCm38) nonsense probably null
R4502:Atm UTSW 9 53,495,946 (GRCm38) missense possibly damaging 0.92
R4514:Atm UTSW 9 53,493,039 (GRCm38) missense probably damaging 0.99
R4528:Atm UTSW 9 53,500,759 (GRCm38) missense probably benign 0.39
R4593:Atm UTSW 9 53,453,594 (GRCm38) missense possibly damaging 0.55
R4627:Atm UTSW 9 53,456,506 (GRCm38) missense possibly damaging 0.79
R4634:Atm UTSW 9 53,531,733 (GRCm38) missense probably benign 0.01
R4665:Atm UTSW 9 53,464,229 (GRCm38) missense probably benign 0.00
R4672:Atm UTSW 9 53,522,201 (GRCm38) missense probably damaging 0.99
R4741:Atm UTSW 9 53,453,607 (GRCm38) missense probably benign 0.10
R4808:Atm UTSW 9 53,445,495 (GRCm38) missense probably damaging 0.99
R4959:Atm UTSW 9 53,515,301 (GRCm38) missense probably benign
R4996:Atm UTSW 9 53,524,507 (GRCm38) missense probably benign 0.09
R5030:Atm UTSW 9 53,520,109 (GRCm38) nonsense probably null
R5214:Atm UTSW 9 53,491,027 (GRCm38) missense probably benign 0.09
R5260:Atm UTSW 9 53,506,611 (GRCm38) missense probably damaging 0.99
R5311:Atm UTSW 9 53,518,623 (GRCm38) missense probably benign 0.00
R5394:Atm UTSW 9 53,507,777 (GRCm38) critical splice donor site probably null
R5400:Atm UTSW 9 53,503,018 (GRCm38) missense probably damaging 1.00
R5436:Atm UTSW 9 53,459,804 (GRCm38) missense probably benign 0.00
R5441:Atm UTSW 9 53,516,467 (GRCm38) nonsense probably null
R5569:Atm UTSW 9 53,516,450 (GRCm38) nonsense probably null
R5856:Atm UTSW 9 53,495,955 (GRCm38) missense possibly damaging 0.64
R5891:Atm UTSW 9 53,497,159 (GRCm38) missense probably benign
R5910:Atm UTSW 9 53,448,080 (GRCm38) missense probably damaging 0.96
R6054:Atm UTSW 9 53,459,873 (GRCm38) missense probably damaging 1.00
R6062:Atm UTSW 9 53,488,587 (GRCm38) missense probably damaging 1.00
R6092:Atm UTSW 9 53,524,414 (GRCm38) missense probably damaging 1.00
R6127:Atm UTSW 9 53,524,509 (GRCm38) missense probably damaging 1.00
R6160:Atm UTSW 9 53,490,959 (GRCm38) missense probably benign 0.04
R6267:Atm UTSW 9 53,444,000 (GRCm38) missense probably damaging 1.00
R6273:Atm UTSW 9 53,487,922 (GRCm38) missense probably benign 0.09
R6284:Atm UTSW 9 53,445,376 (GRCm38) splice site probably null
R6478:Atm UTSW 9 53,490,254 (GRCm38) missense probably damaging 1.00
R6547:Atm UTSW 9 53,440,157 (GRCm38) missense probably damaging 1.00
R6549:Atm UTSW 9 53,493,177 (GRCm38) missense probably benign 0.00
R6704:Atm UTSW 9 53,458,853 (GRCm38) missense probably benign 0.02
R6715:Atm UTSW 9 53,531,648 (GRCm38) missense probably damaging 1.00
R6737:Atm UTSW 9 53,486,051 (GRCm38) missense probably benign 0.30
R6759:Atm UTSW 9 53,518,559 (GRCm38) nonsense probably null
R6766:Atm UTSW 9 53,490,282 (GRCm38) missense probably damaging 0.99
R6813:Atm UTSW 9 53,497,235 (GRCm38) missense probably benign 0.00
R6852:Atm UTSW 9 53,482,430 (GRCm38) missense possibly damaging 0.93
R7064:Atm UTSW 9 53,507,881 (GRCm38) missense probably benign 0.02
R7208:Atm UTSW 9 53,512,008 (GRCm38) splice site probably null
R7211:Atm UTSW 9 53,488,560 (GRCm38) missense probably benign 0.01
R7220:Atm UTSW 9 53,511,917 (GRCm38) nonsense probably null
R7336:Atm UTSW 9 53,462,503 (GRCm38) missense possibly damaging 0.47
R7363:Atm UTSW 9 53,465,298 (GRCm38) missense probably damaging 1.00
R7378:Atm UTSW 9 53,453,437 (GRCm38) critical splice acceptor site probably null
R7472:Atm UTSW 9 53,448,125 (GRCm38) missense possibly damaging 0.81
R7487:Atm UTSW 9 53,524,354 (GRCm38) missense probably benign
R7497:Atm UTSW 9 53,511,891 (GRCm38) missense probably benign 0.00
R7584:Atm UTSW 9 53,513,127 (GRCm38) missense probably damaging 0.99
R7624:Atm UTSW 9 53,454,768 (GRCm38) missense probably damaging 0.99
R7653:Atm UTSW 9 53,490,302 (GRCm38) nonsense probably null
R7660:Atm UTSW 9 53,445,507 (GRCm38) missense probably benign 0.01
R7679:Atm UTSW 9 53,442,497 (GRCm38) missense probably damaging 1.00
R7720:Atm UTSW 9 53,522,239 (GRCm38) missense possibly damaging 0.54
R8221:Atm UTSW 9 53,455,988 (GRCm38) splice site probably null
R8247:Atm UTSW 9 53,450,570 (GRCm38) missense
R8334:Atm UTSW 9 53,522,273 (GRCm38) missense probably benign 0.00
R8503:Atm UTSW 9 53,488,052 (GRCm38) missense probably damaging 0.99
R8552:Atm UTSW 9 53,524,497 (GRCm38) missense probably damaging 1.00
R8749:Atm UTSW 9 53,499,197 (GRCm38) nonsense probably null
R8838:Atm UTSW 9 53,516,551 (GRCm38) missense probably damaging 0.99
R9126:Atm UTSW 9 53,458,834 (GRCm38) missense probably benign 0.01
R9131:Atm UTSW 9 53,533,744 (GRCm38) missense probably benign 0.10
R9191:Atm UTSW 9 53,527,290 (GRCm38) missense probably benign 0.29
R9257:Atm UTSW 9 53,495,850 (GRCm38) critical splice donor site probably null
R9473:Atm UTSW 9 53,498,972 (GRCm38) missense probably benign
R9558:Atm UTSW 9 53,500,781 (GRCm38) missense probably benign 0.00
R9598:Atm UTSW 9 53,520,081 (GRCm38) missense probably benign 0.34
R9717:Atm UTSW 9 53,516,517 (GRCm38) missense probably damaging 1.00
R9794:Atm UTSW 9 53,518,567 (GRCm38) missense probably benign
X0067:Atm UTSW 9 53,479,694 (GRCm38) missense probably benign 0.00
Z1088:Atm UTSW 9 53,531,687 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCATGTGCTAAACACTGTAGGAAAGA -3'
(R):5'- GCCGTGTGTTATGCTCACGTTGAA -3'

Sequencing Primer
(F):5'- actgaggactgaaacccaac -3'
(R):5'- TATAAACTGACAGCGTGGTTGTAAG -3'
Posted On 2014-05-14