Incidental Mutation 'R1703:Itgb5'
ID 189927
Institutional Source Beutler Lab
Gene Symbol Itgb5
Ensembl Gene ENSMUSG00000022817
Gene Name integrin beta 5
Synonyms ESTM23, [b]-5, beta-5, beta5, [b]5, [b]5A, [b]5B
MMRRC Submission 039736-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1703 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 33829665-33949338 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 33910500 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 388 (D388E)
Ref Sequence ENSEMBL: ENSMUSP00000069416 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069345] [ENSMUST00000115028] [ENSMUST00000232262]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000069345
AA Change: D388E

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000069416
Gene: ENSMUSG00000022817
AA Change: D388E

DomainStartEndE-ValueType
PSI 27 76 1.4e-7 SMART
INB 35 463 1.18e-284 SMART
VWA 137 372 5.95e-7 SMART
internal_repeat_1 492 549 3.16e-7 PROSPERO
EGF 554 586 1.95e1 SMART
Integrin_B_tail 635 719 1.56e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115028
AA Change: D388E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000110680
Gene: ENSMUSG00000022817
AA Change: D388E

DomainStartEndE-ValueType
PSI 27 76 1.4e-7 SMART
INB 35 463 1.18e-284 SMART
VWA 137 372 5.95e-7 SMART
internal_repeat_1 492 549 3.16e-7 PROSPERO
EGF 554 586 1.95e1 SMART
Integrin_B_tail 635 719 1.56e-21 SMART
Integrin_b_cyt 743 790 5.97e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134262
Predicted Effect probably benign
Transcript: ENSMUST00000232262
AA Change: D75E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.0769 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.4%
Validation Efficiency 99% (86/87)
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation do not appear to differ from normal in respect to development, reproduction, adenovirus infection, or wound healing. Mutant keratinocytes do show reduced migration on, and adhesion to, vitronectin in vitro. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057M21Rik A T 7: 131,343,702 Y401* probably null Het
4932415M13Rik C A 17: 53,725,037 noncoding transcript Het
Acoxl T A 2: 127,978,772 S81R probably damaging Het
Adamtsl4 A G 3: 95,677,614 C915R probably damaging Het
Adgra3 C T 5: 50,006,775 M287I probably benign Het
Afg1l T G 10: 42,400,399 D250A probably damaging Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Amfr T C 8: 93,974,243 T530A probably benign Het
Ank2 C T 3: 126,929,766 V971M probably damaging Het
App A G 16: 84,965,768 S656P probably damaging Het
Arid5a T A 1: 36,319,575 probably null Het
Asic5 T A 3: 81,999,722 V60D possibly damaging Het
Atm G T 9: 53,500,700 H1019N probably benign Het
Btbd11 A G 10: 85,387,384 D19G unknown Het
Cep250 A G 2: 155,965,546 K277R probably benign Het
Chrna7 C T 7: 63,099,507 R409H probably damaging Het
Chrng A T 1: 87,210,906 N419I possibly damaging Het
Ciao1 T C 2: 127,245,819 S199G probably benign Het
Clstn2 A T 9: 97,458,237 M694K possibly damaging Het
Cpeb2 A G 5: 43,233,838 probably benign Het
Cyp2c69 T A 19: 39,876,366 I223F probably benign Het
Dennd1b A T 1: 139,169,754 probably null Het
Dnah17 A T 11: 118,026,749 L4162Q probably damaging Het
Dnm1 T C 2: 32,323,451 M506V probably benign Het
Ecsit A G 9: 22,074,811 V173A probably damaging Het
Fam13b T C 18: 34,451,439 probably null Het
Fgl2 T A 5: 21,372,732 W6R possibly damaging Het
Galnt9 G A 5: 110,619,172 R503H probably damaging Het
Gm884 C T 11: 103,540,874 V1372I probably benign Het
Gramd1a C T 7: 31,139,534 V247M possibly damaging Het
Grip2 A T 6: 91,777,398 I632N probably damaging Het
Hspg2 T C 4: 137,559,151 V3627A probably damaging Het
Ipo8 T C 6: 148,789,892 Y660C probably benign Het
Isg15 T C 4: 156,199,808 R88G possibly damaging Het
Jhy T C 9: 40,944,837 Y118C probably damaging Het
Kalrn G A 16: 34,205,326 T931M probably damaging Het
Kif21a A G 15: 90,949,047 probably null Het
Lama2 A T 10: 27,266,671 Y604N probably damaging Het
Lrp3 T G 7: 35,213,161 S34R possibly damaging Het
Lyn T C 4: 3,738,867 probably null Het
Mroh8 C T 2: 157,271,976 V132I probably benign Het
Mthfd1l T C 10: 4,148,093 F977L probably damaging Het
Nol8 C T 13: 49,667,457 T912M possibly damaging Het
Nrxn1 A T 17: 90,208,417 N169K probably damaging Het
Olfr1118 T C 2: 87,309,410 V207A probably benign Het
Olfr1188 T A 2: 88,560,255 M262K possibly damaging Het
Oplah A G 15: 76,296,667 Y1279H probably benign Het
Pcsk5 T C 19: 17,752,094 N129S probably benign Het
Pcyt2 G T 11: 120,613,068 P185T probably benign Het
Pdlim2 A G 14: 70,174,335 probably null Het
Pgs1 T C 11: 118,014,728 probably benign Het
Qprt A G 7: 127,108,171 V251A probably benign Het
Rasal2 A C 1: 157,157,600 L834R probably damaging Het
Reg1 T C 6: 78,428,449 C161R probably damaging Het
Rp1 T A 1: 4,345,169 I1907F probably damaging Het
S1pr5 T C 9: 21,244,050 D360G possibly damaging Het
Sart3 C A 5: 113,752,219 V482F probably benign Het
Scarf2 A G 16: 17,802,849 E127G probably damaging Het
Serinc5 T C 13: 92,688,797 S245P probably damaging Het
Serpinc1 G T 1: 160,993,517 R57L probably damaging Het
Setd2 A G 9: 110,549,864 S632G probably benign Het
Sgca A T 11: 94,969,391 L307M probably damaging Het
Slc7a9 C A 7: 35,454,575 Q208K probably benign Het
Slfn10-ps C T 11: 83,030,043 noncoding transcript Het
Spam1 A T 6: 24,796,257 D69V probably damaging Het
Tanc1 A G 2: 59,843,021 E1490G probably benign Het
Tbc1d22a G T 15: 86,239,215 D150Y probably benign Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Tlx1 A G 19: 45,156,004 D55G possibly damaging Het
Tram2 G T 1: 21,004,234 N241K probably damaging Het
Ttc23l T C 15: 10,523,658 Y325C probably damaging Het
Ubac2 T A 14: 121,905,170 S27T probably benign Het
Utrn G A 10: 12,727,729 probably benign Het
Vnn3 A T 10: 23,865,930 M378L probably benign Het
Vps18 T A 2: 119,289,057 D6E probably benign Het
Xkr5 T A 8: 18,939,118 I253F probably benign Het
Yeats4 A T 10: 117,215,723 C210S probably benign Het
Zdhhc20 A G 14: 57,839,088 probably null Het
Other mutations in Itgb5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Itgb5 APN 16 33884975 missense probably damaging 1.00
IGL01121:Itgb5 APN 16 33919989 missense probably benign 0.00
IGL01620:Itgb5 APN 16 33919798 missense probably damaging 1.00
IGL02332:Itgb5 APN 16 33920130 nonsense probably null
IGL02869:Itgb5 APN 16 33844992 missense possibly damaging 0.94
IGL02881:Itgb5 APN 16 33919905 missense probably benign 0.00
IGL02941:Itgb5 APN 16 33944095 splice site probably benign
IGL03216:Itgb5 APN 16 33902838 missense probably benign 0.38
IGL03351:Itgb5 APN 16 33910552 missense probably benign 0.00
PIT4812001:Itgb5 UTSW 16 33919987 missense probably damaging 1.00
R0744:Itgb5 UTSW 16 33900583 missense probably damaging 0.99
R0829:Itgb5 UTSW 16 33944201 missense probably benign 0.29
R0836:Itgb5 UTSW 16 33900583 missense probably damaging 0.99
R1387:Itgb5 UTSW 16 33900515 nonsense probably null
R1783:Itgb5 UTSW 16 33940562 missense probably benign 0.13
R1826:Itgb5 UTSW 16 33865560 missense possibly damaging 0.48
R1889:Itgb5 UTSW 16 33910469 missense probably damaging 1.00
R2374:Itgb5 UTSW 16 33919798 missense probably damaging 1.00
R4307:Itgb5 UTSW 16 33948732 missense possibly damaging 0.80
R4355:Itgb5 UTSW 16 33844997 missense probably damaging 0.98
R4796:Itgb5 UTSW 16 33885021 missense possibly damaging 0.83
R4879:Itgb5 UTSW 16 33875978 missense probably damaging 1.00
R6165:Itgb5 UTSW 16 33899242 missense probably benign 0.01
R6584:Itgb5 UTSW 16 33885030 missense probably damaging 1.00
R6617:Itgb5 UTSW 16 33946592 missense probably benign 0.01
R6748:Itgb5 UTSW 16 33899297 missense probably damaging 1.00
R6979:Itgb5 UTSW 16 33919986 missense probably damaging 1.00
R7090:Itgb5 UTSW 16 33885094 missense probably damaging 1.00
R7150:Itgb5 UTSW 16 33940643 missense probably benign 0.03
R7403:Itgb5 UTSW 16 33902793 critical splice acceptor site probably null
R7418:Itgb5 UTSW 16 33885094 missense probably damaging 1.00
R7719:Itgb5 UTSW 16 33920116 missense probably benign 0.01
R8309:Itgb5 UTSW 16 33865553 missense probably benign 0.00
R8347:Itgb5 UTSW 16 33940678 missense probably damaging 1.00
R8856:Itgb5 UTSW 16 33900592 missense probably damaging 1.00
R9100:Itgb5 UTSW 16 33920181 missense possibly damaging 0.91
R9194:Itgb5 UTSW 16 33900511 missense probably damaging 1.00
R9309:Itgb5 UTSW 16 33920046 missense probably benign 0.00
R9343:Itgb5 UTSW 16 33910456 splice site probably benign
R9629:Itgb5 UTSW 16 33875925 missense probably damaging 1.00
R9683:Itgb5 UTSW 16 33919965 missense probably damaging 0.97
R9710:Itgb5 UTSW 16 33865547 missense probably benign 0.00
X0022:Itgb5 UTSW 16 33845050 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- TGGGAAGCCTCCTGTCTCTAACTTG -3'
(R):5'- CATTCTGGACTAGAAGGCAGAGCAC -3'

Sequencing Primer
(F):5'- TTGGCTTGAACCTCCTGAG -3'
(R):5'- TCCAGGGAGCTACAAAATTGTC -3'
Posted On 2014-05-14