Incidental Mutation 'R1703:App'
ID189929
Institutional Source Beutler Lab
Gene Symbol App
Ensembl Gene ENSMUSG00000022892
Gene Nameamyloid beta (A4) precursor protein
SynonymsAdap, Abeta, protease nexin II, E030013M08Rik, betaAPP, appican, Cvap
MMRRC Submission 039736-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.614) question?
Stock #R1703 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location84949685-85173766 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 84965768 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 656 (S656P)
Ref Sequence ENSEMBL: ENSMUSP00000154061 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005406] [ENSMUST00000226232] [ENSMUST00000226801] [ENSMUST00000227021] [ENSMUST00000227723] [ENSMUST00000227737]
Predicted Effect probably damaging
Transcript: ENSMUST00000005406
AA Change: S581P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000005406
Gene: ENSMUSG00000022892
AA Change: S581P

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
A4_EXTRA 24 188 5.33e-129 SMART
low complexity region 190 208 N/A INTRINSIC
Pfam:APP_E2 291 473 2.5e-77 PFAM
Pfam:Beta-APP 600 638 3.4e-28 PFAM
Pfam:APP_amyloid 641 691 8.6e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000226232
AA Change: S637P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000226801
AA Change: S638P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect unknown
Transcript: ENSMUST00000227021
AA Change: S619P
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227654
Predicted Effect probably damaging
Transcript: ENSMUST00000227723
AA Change: S656P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000227737
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228375
Meta Mutation Damage Score 0.1110 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.4%
Validation Efficiency 99% (86/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cell surface receptor and transmembrane precursor protein that is cleaved by secretases to form a number of peptides. Some of these peptides are secreted and can bind to the acetyltransferase complex APBB1/TIP60 to promote transcriptional activation, while others form the protein basis of the amyloid plaques found in the brains of patients with Alzheimer disease. In addition, two of the peptides are antimicrobial peptides, having been shown to have bacteriocidal and antifungal activities. Mutations in this gene have been implicated in autosomal dominant Alzheimer disease and cerebroarterial amyloidosis (cerebral amyloid angiopathy). Multiple transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene exhibit reduced body weight, brain weight, size of forebrain commissures, locomotor activity, forelimb grip strength, and spatial learning scores. Many mice also exhibit agenesis of the corpus callosum, and extensive reactive gliosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057M21Rik A T 7: 131,343,702 Y401* probably null Het
4932415M13Rik C A 17: 53,725,037 noncoding transcript Het
Acoxl T A 2: 127,978,772 S81R probably damaging Het
Adamtsl4 A G 3: 95,677,614 C915R probably damaging Het
Adgra3 C T 5: 50,006,775 M287I probably benign Het
Afg1l T G 10: 42,400,399 D250A probably damaging Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Amfr T C 8: 93,974,243 T530A probably benign Het
Ank2 C T 3: 126,929,766 V971M probably damaging Het
Arid5a T A 1: 36,319,575 probably null Het
Asic5 T A 3: 81,999,722 V60D possibly damaging Het
Atm G T 9: 53,500,700 H1019N probably benign Het
Btbd11 A G 10: 85,387,384 D19G unknown Het
Cep250 A G 2: 155,965,546 K277R probably benign Het
Chrna7 C T 7: 63,099,507 R409H probably damaging Het
Chrng A T 1: 87,210,906 N419I possibly damaging Het
Ciao1 T C 2: 127,245,819 S199G probably benign Het
Clstn2 A T 9: 97,458,237 M694K possibly damaging Het
Cpeb2 A G 5: 43,233,838 probably benign Het
Cyp2c69 T A 19: 39,876,366 I223F probably benign Het
Dennd1b A T 1: 139,169,754 probably null Het
Dnah17 A T 11: 118,026,749 L4162Q probably damaging Het
Dnm1 T C 2: 32,323,451 M506V probably benign Het
Ecsit A G 9: 22,074,811 V173A probably damaging Het
Fam13b T C 18: 34,451,439 probably null Het
Fgl2 T A 5: 21,372,732 W6R possibly damaging Het
Galnt9 G A 5: 110,619,172 R503H probably damaging Het
Gm884 C T 11: 103,540,874 V1372I probably benign Het
Gramd1a C T 7: 31,139,534 V247M possibly damaging Het
Grip2 A T 6: 91,777,398 I632N probably damaging Het
Hspg2 T C 4: 137,559,151 V3627A probably damaging Het
Ipo8 T C 6: 148,789,892 Y660C probably benign Het
Isg15 T C 4: 156,199,808 R88G possibly damaging Het
Itgb5 T A 16: 33,910,500 D388E probably benign Het
Jhy T C 9: 40,944,837 Y118C probably damaging Het
Kalrn G A 16: 34,205,326 T931M probably damaging Het
Kif21a A G 15: 90,949,047 probably null Het
Lama2 A T 10: 27,266,671 Y604N probably damaging Het
Lrp3 T G 7: 35,213,161 S34R possibly damaging Het
Lyn T C 4: 3,738,867 probably null Het
Mroh8 C T 2: 157,271,976 V132I probably benign Het
Mthfd1l T C 10: 4,148,093 F977L probably damaging Het
Nol8 C T 13: 49,667,457 T912M possibly damaging Het
Nrxn1 A T 17: 90,208,417 N169K probably damaging Het
Olfr1118 T C 2: 87,309,410 V207A probably benign Het
Olfr1188 T A 2: 88,560,255 M262K possibly damaging Het
Oplah A G 15: 76,296,667 Y1279H probably benign Het
Pcsk5 T C 19: 17,752,094 N129S probably benign Het
Pcyt2 G T 11: 120,613,068 P185T probably benign Het
Pdlim2 A G 14: 70,174,335 probably null Het
Pgs1 T C 11: 118,014,728 probably benign Het
Qprt A G 7: 127,108,171 V251A probably benign Het
Rasal2 A C 1: 157,157,600 L834R probably damaging Het
Reg1 T C 6: 78,428,449 C161R probably damaging Het
Rp1 T A 1: 4,345,169 I1907F probably damaging Het
S1pr5 T C 9: 21,244,050 D360G possibly damaging Het
Sart3 C A 5: 113,752,219 V482F probably benign Het
Scarf2 A G 16: 17,802,849 E127G probably damaging Het
Serinc5 T C 13: 92,688,797 S245P probably damaging Het
Serpinc1 G T 1: 160,993,517 R57L probably damaging Het
Setd2 A G 9: 110,549,864 S632G probably benign Het
Sgca A T 11: 94,969,391 L307M probably damaging Het
Slc7a9 C A 7: 35,454,575 Q208K probably benign Het
Slfn10-ps C T 11: 83,030,043 noncoding transcript Het
Spam1 A T 6: 24,796,257 D69V probably damaging Het
Tanc1 A G 2: 59,843,021 E1490G probably benign Het
Tbc1d22a G T 15: 86,239,215 D150Y probably benign Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Tlx1 A G 19: 45,156,004 D55G possibly damaging Het
Tram2 G T 1: 21,004,234 N241K probably damaging Het
Ttc23l T C 15: 10,523,658 Y325C probably damaging Het
Ubac2 T A 14: 121,905,170 S27T probably benign Het
Utrn G A 10: 12,727,729 probably benign Het
Vnn3 A T 10: 23,865,930 M378L probably benign Het
Vps18 T A 2: 119,289,057 D6E probably benign Het
Xkr5 T A 8: 18,939,118 I253F probably benign Het
Yeats4 A T 10: 117,215,723 C210S probably benign Het
Zdhhc20 A G 14: 57,839,088 probably null Het
Other mutations in App
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:App APN 16 84965711 missense probably damaging 0.99
IGL01457:App APN 16 85103239 missense probably damaging 1.00
IGL02016:App APN 16 85056521 missense unknown
IGL02135:App APN 16 85079838 critical splice donor site probably null
IGL02338:App APN 16 85173519 missense probably benign 0.01
IGL02377:App APN 16 85082831 missense probably benign 0.07
IGL02516:App APN 16 84955417 missense probably damaging 1.00
IGL02565:App APN 16 85025420 splice site probably null
IGL03179:App APN 16 85082847 missense probably damaging 1.00
LCD18:App UTSW 16 85025412 splice site probably benign
R0349:App UTSW 16 85013680 missense probably damaging 1.00
R0440:App UTSW 16 85056414 nonsense probably null
R0515:App UTSW 16 85103344 splice site probably benign
R0730:App UTSW 16 85079952 missense probably damaging 0.98
R1609:App UTSW 16 85079949 missense probably damaging 0.97
R2516:App UTSW 16 84978229 missense probably damaging 0.97
R4366:App UTSW 16 85056433 missense unknown
R4735:App UTSW 16 85103314 missense probably damaging 0.99
R4849:App UTSW 16 85056434 missense unknown
R4851:App UTSW 16 85056434 missense unknown
R6254:App UTSW 16 84978177 missense probably damaging 1.00
R6489:App UTSW 16 85056520 missense unknown
R6796:App UTSW 16 85120567 missense probably damaging 0.98
R7132:App UTSW 16 85056482 missense unknown
R7194:App UTSW 16 85025431 missense probably benign 0.40
R7456:App UTSW 16 85173560
R7528:App UTSW 16 84978258 missense possibly damaging 0.89
R7594:App UTSW 16 85080002 missense unknown
R7699:App UTSW 16 85040309 critical splice acceptor site probably null
R7700:App UTSW 16 85040309 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TTGACACAGGACAAGCCACGAG -3'
(R):5'- ACCGCCGTGCAGAGAAATATGAAC -3'

Sequencing Primer
(F):5'- AGGTGCCACGTATTTCATCTG -3'
(R):5'- AAGTTCATTTCCAAAGCCGTGC -3'
Posted On2014-05-14