Incidental Mutation 'R1704:Avpr1b'
ID189940
Institutional Source Beutler Lab
Gene Symbol Avpr1b
Ensembl Gene ENSMUSG00000026432
Gene Namearginine vasopressin receptor 1B
SynonymsVPR3, V1bR, V3/V1b, V3/V1b pituitary vasopressin receptor, AVPR3, V1BR
MMRRC Submission 039737-MU
Accession Numbers

Genbank: NM_011924; MGI: 1347010

Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R1704 (G1)
Quality Score217
Status Not validated
Chromosome1
Chromosomal Location131599239-131612000 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 131609504 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 342 (L342Q)
Ref Sequence ENSEMBL: ENSMUSP00000027690 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027690] [ENSMUST00000190410]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027690
AA Change: L342Q

PolyPhen 2 Score 0.799 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000027690
Gene: ENSMUSG00000026432
AA Change: L342Q

DomainStartEndE-ValueType
Pfam:7tm_4 41 223 1.1e-6 PFAM
Pfam:7TM_GPCR_Srsx 45 342 4.4e-7 PFAM
Pfam:7tm_1 51 335 1.6e-50 PFAM
Pfam:7TM_GPCR_Srv 106 352 8.2e-7 PFAM
DUF1856 359 411 1.6e-21 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000190410
AA Change: C119S

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000140527
Gene: ENSMUSG00000026432
AA Change: C119S

DomainStartEndE-ValueType
Pfam:7tm_1 51 121 8.5e-6 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene acts as receptor for arginine vasopressin. This receptor belongs to the subfamily of G-protein coupled receptors which includes AVPR1A, V2R and OXT receptors. Its activity is mediated by G proteins which stimulate a phosphatidylinositol-calcium second messenger system. The receptor is primarily located in the anterior pituitary, where it stimulates ACTH release. It is expressed at high levels in ACTH-secreting pituitary adenomas as well as in bronchial carcinoids responsible for the ectopic ACTH syndrome. A spliced antisense transcript of this gene has been reported but its function is not known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice for one allele display dysregulation of the hypothalamic-pituitary-adrenal axis activity under stress and resting conditions. Homozygous null mice for other alleles display decreased aggression or an increased propensity for seizures. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, knock-out(4) Targeted, other(1)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adad1 C T 3: 37,092,015 H511Y probably benign Het
Aldh1l2 C T 10: 83,508,660 A341T probably benign Het
Apon T C 10: 128,254,996 F181S probably damaging Het
Cacna1c A T 6: 118,602,146 H1810Q probably benign Het
Camta1 T C 4: 151,075,224 Y1593C probably damaging Het
Cdh23 T A 10: 60,314,611 I2527F probably damaging Het
Cep192 T A 18: 67,856,256 S1825T probably damaging Het
Cntnap4 T A 8: 112,757,523 W403R probably damaging Het
D630045J12Rik G A 6: 38,139,427 P1753S probably benign Het
Dsg4 T C 18: 20,471,589 Y1038H probably damaging Het
Fat1 C T 8: 45,025,576 T2553I probably damaging Het
Fem1c A T 18: 46,506,196 N246K probably benign Het
Frmd8 T A 19: 5,869,482 Q179L probably benign Het
Gbp10 A G 5: 105,224,351 F181S probably damaging Het
Hfe T C 13: 23,704,408 Y265C probably damaging Het
Ispd A G 12: 36,521,494 E279G probably benign Het
Kifap3 A G 1: 163,829,196 N362D possibly damaging Het
Lima1 A G 15: 99,819,736 F130L probably benign Het
Lipo1 A T 19: 33,780,343 V242E possibly damaging Het
Nf1 T A 11: 79,463,301 probably null Het
Nos1ap C G 1: 170,338,212 E161Q probably damaging Het
Olfr224 A T 11: 58,566,754 M197K probably damaging Het
Olfr357 A T 2: 36,996,884 I25F probably benign Het
Pde4dip C T 3: 97,754,260 V611I probably benign Het
Pdk2 T C 11: 95,028,550 I300V possibly damaging Het
Polr2b A G 5: 77,342,560 D849G possibly damaging Het
Polr3a G A 14: 24,484,120 Q106* probably null Het
Prr14l G T 5: 32,830,282 A623D probably benign Het
Rab43 A C 6: 87,811,381 probably null Het
Sart3 G A 5: 113,746,007 T648M probably benign Het
Scn10a T C 9: 119,609,394 D1803G probably damaging Het
Sec11a A T 7: 80,935,100 S30T possibly damaging Het
Sez6l2 G A 7: 126,958,341 G309E probably damaging Het
Snx14 A C 9: 88,413,538 D191E probably damaging Het
Sox6 A T 7: 115,476,948 N777K possibly damaging Het
Susd4 A G 1: 182,854,113 N173S probably damaging Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Tgfbrap1 G T 1: 43,054,656 Q559K probably benign Het
Tmco1 T C 1: 167,325,937 S129P possibly damaging Het
Tmprss11a T C 5: 86,428,702 T97A probably benign Het
Tnni3k G A 3: 154,827,508 A774V probably benign Het
Tshz3 T C 7: 36,771,360 S925P possibly damaging Het
Ush2a T C 1: 188,821,796 V3494A probably damaging Het
Vmn2r9 T C 5: 108,846,400 D461G probably damaging Het
Zan A T 5: 137,434,002 C2344* probably null Het
Zfp629 A G 7: 127,610,864 I591T probably benign Het
Zfp955a G A 17: 33,241,725 R478* probably null Het
Zmym1 A T 4: 127,048,384 I737N probably damaging Het
Zranb3 T C 1: 128,092,003 M1V probably null Het
Other mutations in Avpr1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01615:Avpr1b APN 1 131600147 missense probably damaging 1.00
IGL02516:Avpr1b APN 1 131600629 missense probably damaging 0.98
IGL02708:Avpr1b APN 1 131600651 missense probably damaging 1.00
IGL03122:Avpr1b APN 1 131600519 missense probably damaging 1.00
R0058:Avpr1b UTSW 1 131599786 missense probably benign 0.04
R0058:Avpr1b UTSW 1 131599786 missense probably benign 0.04
R0654:Avpr1b UTSW 1 131599742 start codon destroyed probably null 0.98
R0690:Avpr1b UTSW 1 131600281 missense probably damaging 0.99
R1470:Avpr1b UTSW 1 131600585 missense probably damaging 1.00
R1470:Avpr1b UTSW 1 131600585 missense probably damaging 1.00
R1732:Avpr1b UTSW 1 131600254 missense probably damaging 1.00
R1754:Avpr1b UTSW 1 131600101 missense probably damaging 1.00
R6103:Avpr1b UTSW 1 131609417 missense probably damaging 1.00
R7246:Avpr1b UTSW 1 131600270 missense probably damaging 1.00
R7283:Avpr1b UTSW 1 131609731 missense probably benign 0.26
R8253:Avpr1b UTSW 1 131609416 missense probably benign 0.41
Z1176:Avpr1b UTSW 1 131609573 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCACTGATCCCTCTTGAGTTGTGA -3'
(R):5'- TCCAAATCCTTCAGCGAGCCCG -3'

Sequencing Primer
(F):5'- cccacccacccactctc -3'
(R):5'- CGAGCCCGCAGGCTTAG -3'
Posted On2014-05-14