Incidental Mutation 'R1704:Camta1'
ID189955
Institutional Source Beutler Lab
Gene Symbol Camta1
Ensembl Gene ENSMUSG00000014592
Gene Namecalmodulin binding transcription activator 1
Synonyms1810059M14Rik, 2310058O09Rik
MMRRC Submission 039737-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.508) question?
Stock #R1704 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location150917322-151861876 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 151075224 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 1593 (Y1593C)
Ref Sequence ENSEMBL: ENSMUSP00000127916 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049790] [ENSMUST00000097774] [ENSMUST00000105668] [ENSMUST00000105670] [ENSMUST00000140030] [ENSMUST00000169423]
Predicted Effect probably damaging
Transcript: ENSMUST00000049790
AA Change: Y1593C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000054804
Gene: ENSMUSG00000014592
AA Change: Y1593C

DomainStartEndE-ValueType
CG-1 67 183 1.39e-91 SMART
low complexity region 550 583 N/A INTRINSIC
low complexity region 677 688 N/A INTRINSIC
Pfam:TIG 874 954 3e-13 PFAM
low complexity region 997 1030 N/A INTRINSIC
ANK 1066 1095 1.7e2 SMART
ANK 1111 1141 4.73e2 SMART
low complexity region 1301 1319 N/A INTRINSIC
IQ 1548 1564 2.38e2 SMART
IQ 1578 1600 5.42e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000097774
AA Change: Y1586C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095381
Gene: ENSMUSG00000014592
AA Change: Y1586C

DomainStartEndE-ValueType
CG-1 67 183 1.39e-91 SMART
low complexity region 550 583 N/A INTRINSIC
low complexity region 677 688 N/A INTRINSIC
Pfam:TIG 874 954 3.1e-11 PFAM
low complexity region 997 1030 N/A INTRINSIC
ANK 1066 1095 1.7e2 SMART
ANK 1111 1141 4.73e2 SMART
low complexity region 1301 1319 N/A INTRINSIC
IQ 1548 1570 5.45e1 SMART
IQ 1571 1593 5.42e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105668
AA Change: Y502C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101293
Gene: ENSMUSG00000014592
AA Change: Y502C

DomainStartEndE-ValueType
low complexity region 19 52 N/A INTRINSIC
ANK 88 117 1.7e2 SMART
ANK 133 163 4.73e2 SMART
Blast:ANK 167 197 6e-10 BLAST
IQ 457 473 2.38e2 SMART
IQ 487 509 5.42e0 SMART
Pfam:IQ 512 527 5.1e-4 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105670
AA Change: Y495C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101295
Gene: ENSMUSG00000014592
AA Change: Y495C

DomainStartEndE-ValueType
low complexity region 19 52 N/A INTRINSIC
ANK 88 117 1.7e2 SMART
ANK 133 163 4.73e2 SMART
Blast:ANK 167 197 5e-10 BLAST
IQ 457 479 5.45e1 SMART
IQ 480 502 5.42e0 SMART
Pfam:IQ 505 520 5.1e-4 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000140030
AA Change: Y149C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119067
Gene: ENSMUSG00000014592
AA Change: Y149C

DomainStartEndE-ValueType
IQ 111 133 5.45e1 SMART
IQ 134 156 5.42e0 SMART
Pfam:IQ 159 174 8.5e-4 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000169423
AA Change: Y1593C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127916
Gene: ENSMUSG00000014592
AA Change: Y1593C

DomainStartEndE-ValueType
CG-1 67 183 1.39e-91 SMART
low complexity region 550 583 N/A INTRINSIC
low complexity region 677 688 N/A INTRINSIC
Pfam:TIG 874 954 3.1e-11 PFAM
low complexity region 997 1030 N/A INTRINSIC
ANK 1066 1095 1.7e2 SMART
ANK 1111 1141 4.73e2 SMART
low complexity region 1301 1319 N/A INTRINSIC
IQ 1548 1564 2.38e2 SMART
IQ 1578 1600 5.42e0 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Global or nervous system deletion of this gene results in decreased body size, severe ataxia, progressive Purkinje cell degeneration, and cerebellar atrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adad1 C T 3: 37,092,015 H511Y probably benign Het
Aldh1l2 C T 10: 83,508,660 A341T probably benign Het
Apon T C 10: 128,254,996 F181S probably damaging Het
Avpr1b T A 1: 131,609,504 L342Q possibly damaging Het
Cacna1c A T 6: 118,602,146 H1810Q probably benign Het
Cdh23 T A 10: 60,314,611 I2527F probably damaging Het
Cep192 T A 18: 67,856,256 S1825T probably damaging Het
Cntnap4 T A 8: 112,757,523 W403R probably damaging Het
D630045J12Rik G A 6: 38,139,427 P1753S probably benign Het
Dsg4 T C 18: 20,471,589 Y1038H probably damaging Het
Fat1 C T 8: 45,025,576 T2553I probably damaging Het
Fem1c A T 18: 46,506,196 N246K probably benign Het
Frmd8 T A 19: 5,869,482 Q179L probably benign Het
Gbp10 A G 5: 105,224,351 F181S probably damaging Het
Hfe T C 13: 23,704,408 Y265C probably damaging Het
Ispd A G 12: 36,521,494 E279G probably benign Het
Kifap3 A G 1: 163,829,196 N362D possibly damaging Het
Lima1 A G 15: 99,819,736 F130L probably benign Het
Lipo1 A T 19: 33,780,343 V242E possibly damaging Het
Nf1 T A 11: 79,463,301 probably null Het
Nos1ap C G 1: 170,338,212 E161Q probably damaging Het
Olfr224 A T 11: 58,566,754 M197K probably damaging Het
Olfr357 A T 2: 36,996,884 I25F probably benign Het
Pde4dip C T 3: 97,754,260 V611I probably benign Het
Pdk2 T C 11: 95,028,550 I300V possibly damaging Het
Polr2b A G 5: 77,342,560 D849G possibly damaging Het
Polr3a G A 14: 24,484,120 Q106* probably null Het
Prr14l G T 5: 32,830,282 A623D probably benign Het
Rab43 A C 6: 87,811,381 probably null Het
Sart3 G A 5: 113,746,007 T648M probably benign Het
Scn10a T C 9: 119,609,394 D1803G probably damaging Het
Sec11a A T 7: 80,935,100 S30T possibly damaging Het
Sez6l2 G A 7: 126,958,341 G309E probably damaging Het
Snx14 A C 9: 88,413,538 D191E probably damaging Het
Sox6 A T 7: 115,476,948 N777K possibly damaging Het
Susd4 A G 1: 182,854,113 N173S probably damaging Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Tgfbrap1 G T 1: 43,054,656 Q559K probably benign Het
Tmco1 T C 1: 167,325,937 S129P possibly damaging Het
Tmprss11a T C 5: 86,428,702 T97A probably benign Het
Tnni3k G A 3: 154,827,508 A774V probably benign Het
Tshz3 T C 7: 36,771,360 S925P possibly damaging Het
Ush2a T C 1: 188,821,796 V3494A probably damaging Het
Vmn2r9 T C 5: 108,846,400 D461G probably damaging Het
Zan A T 5: 137,434,002 C2344* probably null Het
Zfp629 A G 7: 127,610,864 I591T probably benign Het
Zfp955a G A 17: 33,241,725 R478* probably null Het
Zmym1 A T 4: 127,048,384 I737N probably damaging Het
Zranb3 T C 1: 128,092,003 M1V probably null Het
Other mutations in Camta1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00552:Camta1 APN 4 151071424 critical splice donor site probably null
IGL00823:Camta1 APN 4 151084601 missense probably benign 0.02
IGL01361:Camta1 APN 4 151144692 missense probably damaging 1.00
IGL01523:Camta1 APN 4 151145050 missense possibly damaging 0.73
IGL01730:Camta1 APN 4 151062845 missense probably damaging 0.99
IGL02045:Camta1 APN 4 151073985 splice site probably null
IGL02541:Camta1 APN 4 151084655 missense probably benign 0.12
IGL02839:Camta1 APN 4 151144512 missense probably damaging 1.00
IGL03012:Camta1 APN 4 151453299 missense probably damaging 1.00
Bonus UTSW 4 151138375 missense probably damaging 1.00
PIT4449001:Camta1 UTSW 4 151131586 missense probably benign 0.00
R0136:Camta1 UTSW 4 151078969 missense probably damaging 0.99
R0239:Camta1 UTSW 4 151143730 missense probably damaging 1.00
R0239:Camta1 UTSW 4 151143730 missense probably damaging 1.00
R0276:Camta1 UTSW 4 151075140 missense probably damaging 1.00
R0346:Camta1 UTSW 4 151075140 missense probably damaging 1.00
R0347:Camta1 UTSW 4 151075140 missense probably damaging 1.00
R0348:Camta1 UTSW 4 151586431 missense possibly damaging 0.64
R0385:Camta1 UTSW 4 151075140 missense probably damaging 1.00
R0386:Camta1 UTSW 4 151075140 missense probably damaging 1.00
R0388:Camta1 UTSW 4 151075140 missense probably damaging 1.00
R0410:Camta1 UTSW 4 151075140 missense probably damaging 1.00
R0456:Camta1 UTSW 4 151075140 missense probably damaging 1.00
R0478:Camta1 UTSW 4 151075140 missense probably damaging 1.00
R0510:Camta1 UTSW 4 151075140 missense probably damaging 1.00
R0511:Camta1 UTSW 4 151075140 missense probably damaging 1.00
R0683:Camta1 UTSW 4 151075140 missense probably damaging 1.00
R0724:Camta1 UTSW 4 151077892 missense probably damaging 1.00
R0732:Camta1 UTSW 4 151586484 critical splice acceptor site probably null
R1549:Camta1 UTSW 4 151586463 missense probably damaging 1.00
R1670:Camta1 UTSW 4 151079771 missense probably benign 0.00
R1718:Camta1 UTSW 4 151084024 missense probably benign 0.00
R1941:Camta1 UTSW 4 151075155 missense probably damaging 1.00
R1967:Camta1 UTSW 4 151088973 missense probably damaging 0.99
R1998:Camta1 UTSW 4 151077880 missense probably damaging 1.00
R2081:Camta1 UTSW 4 151144242 missense probably benign 0.24
R2104:Camta1 UTSW 4 151453294 missense probably damaging 0.99
R2240:Camta1 UTSW 4 151084575 missense possibly damaging 0.66
R4516:Camta1 UTSW 4 151144720 missense possibly damaging 0.90
R4539:Camta1 UTSW 4 151084812 missense probably benign 0.03
R4552:Camta1 UTSW 4 151792502 missense probably damaging 0.96
R4610:Camta1 UTSW 4 151084827 missense probably damaging 1.00
R4658:Camta1 UTSW 4 151143910 missense probably damaging 1.00
R4725:Camta1 UTSW 4 151148496 missense probably benign 0.11
R4786:Camta1 UTSW 4 151290039 missense probably damaging 1.00
R4812:Camta1 UTSW 4 151131542 missense probably null 0.25
R4840:Camta1 UTSW 4 151144407 missense probably benign 0.23
R5038:Camta1 UTSW 4 151145469 missense probably damaging 1.00
R5112:Camta1 UTSW 4 151074054 missense probably damaging 1.00
R5251:Camta1 UTSW 4 151163884 missense probably damaging 1.00
R5388:Camta1 UTSW 4 151075238 missense probably damaging 1.00
R5487:Camta1 UTSW 4 151144754 missense possibly damaging 0.73
R6343:Camta1 UTSW 4 151079849 missense probably damaging 0.98
R6462:Camta1 UTSW 4 151086164 missense probably damaging 0.98
R6550:Camta1 UTSW 4 151138375 missense probably damaging 1.00
R6990:Camta1 UTSW 4 151145044 missense probably damaging 0.97
R7165:Camta1 UTSW 4 151084700 missense possibly damaging 0.63
R7190:Camta1 UTSW 4 151148523 missense possibly damaging 0.57
R7215:Camta1 UTSW 4 151144737 missense probably damaging 1.00
R7264:Camta1 UTSW 4 151453399 missense probably damaging 1.00
R7403:Camta1 UTSW 4 151453295 nonsense probably null
R7445:Camta1 UTSW 4 151144291 missense possibly damaging 0.94
R7447:Camta1 UTSW 4 151083870 missense probably benign 0.31
R7585:Camta1 UTSW 4 151144830 missense probably damaging 1.00
R7881:Camta1 UTSW 4 151835876 missense probably damaging 0.99
R7964:Camta1 UTSW 4 151835876 missense probably damaging 0.99
R8057:Camta1 UTSW 4 151144032 missense probably damaging 1.00
R8073:Camta1 UTSW 4 151078824 missense probably damaging 1.00
X0063:Camta1 UTSW 4 151145247 missense probably damaging 1.00
Z1176:Camta1 UTSW 4 151144385 missense probably benign 0.06
Z1177:Camta1 UTSW 4 151077925 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATCACTGAGCCCTGAGCCCTATG -3'
(R):5'- ACTGGAAGCTTGCTGTTGGCATC -3'

Sequencing Primer
(F):5'- CTCTCCTGAAGTAATTAGGGAGTC -3'
(R):5'- CATCCTGAGGTTGGCTCC -3'
Posted On2014-05-14