Incidental Mutation 'R1704:Tmprss11a'
ID189958
Institutional Source Beutler Lab
Gene Symbol Tmprss11a
Ensembl Gene ENSMUSG00000072845
Gene Nametransmembrane protease, serine 11a
SynonymsLOC194597
MMRRC Submission 039737-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1704 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location86410410-86468990 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86428702 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 97 (T97A)
Ref Sequence ENSEMBL: ENSMUSP00000098634 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101073]
Predicted Effect probably benign
Transcript: ENSMUST00000101073
AA Change: T97A

PolyPhen 2 Score 0.251 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000098634
Gene: ENSMUSG00000072845
AA Change: T97A

DomainStartEndE-ValueType
low complexity region 17 32 N/A INTRINSIC
Pfam:SEA 36 135 3.2e-23 PFAM
Tryp_SPc 157 383 1.98e-87 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mice for a targeted mutation appear normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adad1 C T 3: 37,092,015 H511Y probably benign Het
Aldh1l2 C T 10: 83,508,660 A341T probably benign Het
Apon T C 10: 128,254,996 F181S probably damaging Het
Avpr1b T A 1: 131,609,504 L342Q possibly damaging Het
Cacna1c A T 6: 118,602,146 H1810Q probably benign Het
Camta1 T C 4: 151,075,224 Y1593C probably damaging Het
Cdh23 T A 10: 60,314,611 I2527F probably damaging Het
Cep192 T A 18: 67,856,256 S1825T probably damaging Het
Cntnap4 T A 8: 112,757,523 W403R probably damaging Het
D630045J12Rik G A 6: 38,139,427 P1753S probably benign Het
Dsg4 T C 18: 20,471,589 Y1038H probably damaging Het
Fat1 C T 8: 45,025,576 T2553I probably damaging Het
Fem1c A T 18: 46,506,196 N246K probably benign Het
Frmd8 T A 19: 5,869,482 Q179L probably benign Het
Gbp10 A G 5: 105,224,351 F181S probably damaging Het
Hfe T C 13: 23,704,408 Y265C probably damaging Het
Ispd A G 12: 36,521,494 E279G probably benign Het
Kifap3 A G 1: 163,829,196 N362D possibly damaging Het
Lima1 A G 15: 99,819,736 F130L probably benign Het
Lipo1 A T 19: 33,780,343 V242E possibly damaging Het
Nf1 T A 11: 79,463,301 probably null Het
Nos1ap C G 1: 170,338,212 E161Q probably damaging Het
Olfr224 A T 11: 58,566,754 M197K probably damaging Het
Olfr357 A T 2: 36,996,884 I25F probably benign Het
Pde4dip C T 3: 97,754,260 V611I probably benign Het
Pdk2 T C 11: 95,028,550 I300V possibly damaging Het
Polr2b A G 5: 77,342,560 D849G possibly damaging Het
Polr3a G A 14: 24,484,120 Q106* probably null Het
Prr14l G T 5: 32,830,282 A623D probably benign Het
Rab43 A C 6: 87,811,381 probably null Het
Sart3 G A 5: 113,746,007 T648M probably benign Het
Scn10a T C 9: 119,609,394 D1803G probably damaging Het
Sec11a A T 7: 80,935,100 S30T possibly damaging Het
Sez6l2 G A 7: 126,958,341 G309E probably damaging Het
Snx14 A C 9: 88,413,538 D191E probably damaging Het
Sox6 A T 7: 115,476,948 N777K possibly damaging Het
Susd4 A G 1: 182,854,113 N173S probably damaging Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Tgfbrap1 G T 1: 43,054,656 Q559K probably benign Het
Tmco1 T C 1: 167,325,937 S129P possibly damaging Het
Tnni3k G A 3: 154,827,508 A774V probably benign Het
Tshz3 T C 7: 36,771,360 S925P possibly damaging Het
Ush2a T C 1: 188,821,796 V3494A probably damaging Het
Vmn2r9 T C 5: 108,846,400 D461G probably damaging Het
Zan A T 5: 137,434,002 C2344* probably null Het
Zfp629 A G 7: 127,610,864 I591T probably benign Het
Zfp955a G A 17: 33,241,725 R478* probably null Het
Zmym1 A T 4: 127,048,384 I737N probably damaging Het
Zranb3 T C 1: 128,092,003 M1V probably null Het
Other mutations in Tmprss11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01596:Tmprss11a APN 5 86422519 missense probably damaging 1.00
IGL02413:Tmprss11a APN 5 86422648 missense possibly damaging 0.50
IGL02533:Tmprss11a APN 5 86414527 missense probably damaging 0.96
R1202:Tmprss11a UTSW 5 86411925 critical splice acceptor site probably null
R1273:Tmprss11a UTSW 5 86414588 missense probably benign 0.10
R1756:Tmprss11a UTSW 5 86420179 missense probably damaging 1.00
R1783:Tmprss11a UTSW 5 86420032 missense probably damaging 0.98
R1967:Tmprss11a UTSW 5 86431843 missense probably benign 0.23
R2944:Tmprss11a UTSW 5 86428652 missense probably benign 0.19
R3881:Tmprss11a UTSW 5 86445805 missense possibly damaging 0.85
R4512:Tmprss11a UTSW 5 86428578 missense probably benign 0.00
R4515:Tmprss11a UTSW 5 86420196 missense probably damaging 1.00
R4530:Tmprss11a UTSW 5 86428681 missense possibly damaging 0.79
R4543:Tmprss11a UTSW 5 86411809 nonsense probably null
R4881:Tmprss11a UTSW 5 86422573 missense probably damaging 1.00
R5066:Tmprss11a UTSW 5 86420000 critical splice donor site probably null
R5186:Tmprss11a UTSW 5 86420079 missense probably damaging 1.00
R5254:Tmprss11a UTSW 5 86411806 missense probably damaging 0.99
R5313:Tmprss11a UTSW 5 86411815 missense probably damaging 1.00
R6516:Tmprss11a UTSW 5 86420128 missense probably damaging 1.00
R6920:Tmprss11a UTSW 5 86428635 missense probably benign 0.23
R7018:Tmprss11a UTSW 5 86428570 missense probably damaging 0.96
R7566:Tmprss11a UTSW 5 86444134 missense possibly damaging 0.50
R7962:Tmprss11a UTSW 5 86420020 missense probably damaging 1.00
X0057:Tmprss11a UTSW 5 86445808 missense probably benign 0.03
X0063:Tmprss11a UTSW 5 86414578 missense probably damaging 1.00
Z1176:Tmprss11a UTSW 5 86428631 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGCAGCTCTAAATGCAGGTTACCTC -3'
(R):5'- AAGTAAGGATGTGAGCATATTGCCTGG -3'

Sequencing Primer
(F):5'- TGTCTTTAGAAGGTCCAACCCAG -3'
(R):5'- ATATTGCCTGGCGCTTGAC -3'
Posted On2014-05-14